Australia certainly was a lot of crooks here.

Canada 🇨🇦 too. All should be held responsible.

WHO

Because they were paid

@StirlingLighthouse You mean Post National Canada comrade

hear hear

But who ordered it? Adolf Schwaab?

My dad took the Pfizer boosters, subsequently got a heart attack, clotting in his feet, cellulitis and had multiple organ failure. A healthy man who walked more than athletes everyday, read libraries of books, did incredible real charity at the cost of his own wealth/meals at times, a guy who had salads daily, no stresses, did yoga and everyone thought would live to 100+. He passed away last year, we were told by doctors he had a heart attack as the causative factor. We all believe IT IS THE PFIZER-BIONTECH vaccine to blame squarely.

@@Plisken65 One of that lot

They feel no guilt, fhey are evil

The uk’s no better

Because in America they can't be held legally reliable. Obama made sure of that.

The Canadian government has KZfaq put a warning banner under the video telling us to go to Health Canada for accurate information.

@@GordieGiiyes I can confirm it’s true

Neither here in Canada - but then after the way Trudeau went vax yatzee on everyone they certainly don't want Canadians to know. No wonder they want to control all the media.

No, all they care about is the money they're making.

Until they have loved ones of their own.. even then I don’t think these corporate overlords are capable of sympathy.

Neither, do they face justice!

United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats?? Military created the poison. Depopulation !

@@joe9042they do. Karmic laws will destroy them. Maybe not in this life but it’s prepared and everybody’s gonna get the taste of their own shit + more.

that's anti-semitic

@@user-vs6xj2qe2g Lol.

they supported pseudo-science while suppressing (with a lot of help) real evidence based science

🎯🎯🎯

worse. history hasn't been happy with them multiple times. they were expelled over 100 times from almost every nation for behaviour like this.

🎯🎯🎯

AMEN.UNDER IT.❤❤

Absolutely

6 feet deeply :)

Amen. Pray for Nuremberg Trials.

That's exactly how it was. They also said you can't work unless you take it.

Or can’t travel or visit hospital patients?

Or swim or go to the restaurants in Trumps hotels. Does everybody forget that he backed them right up?

@@katesun2957 dont care about your politics, this is crime against humanity

Everybody can sue. Their exemption is not valid since they knew what they were doing.

Very sad.

To withdraw it now after pushing it so heavily would be admitting culpability, and the claims will flood in, as pfizer is protected from liabilty, so the gov will have to renumerate people for lives destroyed. Money trumps human life.

see Hugo talks: Spanish Flu Bolshevik Revolution HISTORY REPEATING?

They push it period. Signs in "doctors'" offices, pharmacies. "Get your free covid shot here". They really think we're that stupid. INSULTING!

Slowly... the people starting to realize what the pharmaceutical industry and the governments ACTUALLY is about. In reality.

And all your favourite celebrities

Yes NEVER forget.

Big money and deep state rule the Western world 😢😢😢

Juist Dat is een grote schoft en geldwolf

NEVER forget willigoats. If it's anti-GOD's creation, if it's anti-human....Sauron, private bankers (you-know-who) & willigoats are somewhere close by pulling strings.

Souls aren't real.

@@maishagrinn4681 Thanks for contributing absolutely nothing to the comments. 👍🏻

@@antagenvictim And women contribute nothing to the world at all but bs.

​@@antagenvictimit's your fault for that guy's comment, next time do not mention the unreal

@@haurg7418It’s a figure of speech, dork.

Deeply sorry they were exposed !

corporations can hurt anyone they want, and nobody behind the company will be held accountable. this is what happens when you treat corporations as people. no body to imprison, and no soul to save.

Don't be anti-Semitic.

You've got to prove it in a court of law first. And remember the manufacturers have legal indemnity.

CEO of Pfizer is ✡️....CDC director is ✡️...COVID Czar was ✡️... coincidence 🤔???

Almost all governments were working with them. Who is to hold them accountable when the people that would do that are also in on it. This wasnt just 1 company doing this..

Trillions. For those going through this, some extended fasting, low carb diet, taurine and methylene blue can help a great deal. Some benefits of occasional extended fasting and lowering carbs in the diet: High blood pressure is lowered to normal levels very quickly while fasting. Fibrosis/scarring is reversed over time, including in the heart and lungs. Vitamin D plasma levels are increased as fasting improves metabolic health, and vitamin D in turn increases autophagy. When insulin is high, vit D stays locked in the blood cells. Fasting stimulates phagocytosis, the ingestion plaques, growths and pathogens by the immune system. This will also remove spikes quicker, whether natural or unnatural in origin! Your body recycles up to 1/3 of all immune bodies in a 72h fast, rejuvenating your entire immune system. This helps with autoimmune disease, cancers and cytokine storm. Fasts from 36-96 h increase metabolic rate due to norepinephrine release! Clots and plaques are removed over time due to accelerated phsocytosis. Fasting improves your circadian rhythm to normal over time. Blood sugar and insulin are lowered when fasting, reducing inflammation and allowing the immune bodies to move freely through the body. T cells and T reg cells are vital in fighting cancer, autoimmune disease and infections. As we age, the thymus stops making as many of them but fasting releases stem cells, which then can become new T cells. It also releases growth hormone, which regenerates the thymus itself! Fasting increases anti-aging Yamanaka factors and increases average telomere length in stem cell pools. Fasting can help with MS, Depression, BPD, Autism and seizures. When you move out of MTOR your body shuts down the building blocks of the cell required for viruses to replicate. The hunger hormone ghrelin also lowers with extended fasting and rises from dieting. What breaks a fast? Anything with protein or carbohydrates in it will break a fast but most teas and herbs are OK. Supplements and meds often break ketosis directly or contain a filler that will. Many meds are dangerous to take while fasting. Does fasting lower testosterone? No, it raises it when the fast is broken by increasing lutenizing hormone. Fasting also increases insulin sensitivity, which helps with muscle building. Fasting activates autophagy (literally self eating). This will cause cells to recycle damaged proteins and foreign matter such as viruses. Lowering insulin via fasting virtually eliminates chronic inflammation in the body. Weight loss from daily caloric restriction has 1/4 to 1/3 of the weight lost as lean tissue while many studies show fat loss from 36 h fasts without losing any lean tissue! Fasts of 36-96 will not affect short term female fertility or affect menstrual cycle. They also may increase long term fertility for some women. It increases mitochondrial function and repairs mitochondrial DNA, leading to improved ATP production and oxygen efficiency. Increased mitochondrial function also has the added benefit of increasing your metabolism, fighting infection and cancer prevention! 24h of fasting can cut your leptin levels in half! This reduces leptin resistance, which impairs immune function. Fasting reduces pain and anxiety by stimulating the endocannabinoid system, just like the effect of CBD oil Stomach acid is reduced over time while fasting and can allow for the healing of treatment resistant ulcers. Some patients may need continued acid reduction medication while fasting. When the fast is completed, your stomach acid levels will be normalized. Your brain also prefers to burn ketones at a rate of around 2.5 to 1 when they are available in equal quantity to glucose. Except for brief periods of very intense exercise, your body mainly burns fats in the form of free fatty acids. Fasting releases BDNF and NGF in the blood. This stimulates new nerve and brain cell growth, which can help a great deal with diseases like MS, peripheral neuropathy and Alzheimers. When not in ketosis, the brain can only burn carbohydrate, which produces a great deal of damaging ROS the brain has to deal with. Fasting increases telomere length, negating some of the effects of aging at a cellular level. When you fast, this stimulates apoptosis in senescent or genetically damaged cells, destroying them. Senescent cells are responsible for many of the effects of aging and are a root cause of the development of cancer. A fasting mimicking diet for 3-5 days in a row provides many of the same benefits as water fasting. FMD usually has 200-800 calories, under 18 g of protein and extremely low carbs. Exogenous ketones can aid with fasting, making it easier in healthy people and allowing some people with specific issues to fast in spite of them without worrying as much about hypoglycemia. They also help with dementia and many other issues even if you take them while not fasting! Glycine and trimethylglycine can also be useful supplements while fasting that won't break ketosis and have many benefits. Children, pregnant or nursing women should not fast for periods longer than 16 hours. People with pancreatic tumors or certain forms of hypoglycemia generally cannot fast at all. Type 1 diabetics can also fast but it is more complicated and should be approached with caution as it could lead to ketoacidosis. If you experience extreme symptoms of some kind, especially dizziness or tremors, then simply break the fast and seek advice. Resources: www.ncbi.nlm.nih.gov/pmc/articles/PMC6141719/ www.ncbi.nlm.nih.gov/pmc/articles/PMC3017674/ www.sciencedirect.com/science/article/pii/S0005272806000223 www.clinicaltrials.gov/ct2/show/NCT04375657 www.nejm.org/doi/full/10.1056/NEJMc2001176 pubmed.ncbi.nlm.nih.gov/31877297/ www.ncbi.nlm.nih.gov/gene/25712 pubmed.ncbi.nlm.nih.gov/20921964/ pubmed.ncbi.nlm.nih.gov/29727683/ www.ncbi.nlm.nih.gov/pmc/articles/PMC5895342/ pubmed.ncbi.nlm.nih.gov/33530881/ www.arcjournals.org/pdfs/ijrsb/v3-i11/7.pdf pubmed.ncbi.nlm.nih.gov/27569118/ www.cell.com/cell-metabolism/abstract/S1550-4131(15)00224-7 clinical.diabetesjournals.org/content/36/3/217 www.ncbi.nlm.nih.gov/pubmed/23876457 www.sciencedirect.com/science/article/pii/S1931312809002832 pubmed.ncbi.nlm.nih.gov/15522942/ www.ncbi.nlm.nih.gov/pmc/articles/PMC7607739/ www.ncbi.nlm.nih.gov/pmc/articles/PMC7093158/ www.ncbi.nlm.nih.gov/pubmed/10859646 www.ncbi.nlm.nih.gov/pmc/articles/PMC6407435/ www.cell.com/molecular-cell/fulltext/S1097-2765(18)30605-1?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS1097276518306051%3Fshowall%3Dtrue pubmed.ncbi.nlm.nih.gov/28235195/ www.ncbi.nlm.nih.gov/pmc/articles/PMC2815756/ www.nia.nih.gov/news/research-intermittent-fasting-shows-health-benefits medicalxpress.com/news/2022-10-treatment-pulmonary-fibrosis-focus-telomeres.html www.cell.com/cell/fulltext/S0092-8674(19)30849-9 onlinelibrary.wiley.com/doi/full/10.1111/j.1365-2265.2005.02288.x pubmed.ncbi.nlm.nih.gov/25909219/ repository.upenn.edu/cgi/viewcontent.cgi?article=1537&context=edissertations www.ncbi.nlm.nih.gov/pmc/articles/PMC1779438/ academic.oup.com/ajcn/article/81/1/69/4607679 www.amjmedsci.org/article/S0002-9629%2815%2900027-0/fulltext www.collective-evolution.com/2017/05/16/study-shows-how-fasting-for-3-days-can-regenerate-your-entire-immune-system/ pubmed.ncbi.nlm.nih.gov/7714088/ www.nejm.org/doi/full/10.1056/NEJMoa012908 pubmed.ncbi.nlm.nih.gov/23707514/ pubmed.ncbi.nlm.nih.gov/23408502/ faseb.onlinelibrary.wiley.com/doi/abs/10.1096/fasebj.2019.33.1_supplement.819.10 www.biorxiv.org/node/93305.full www.health.harvard.edu/heart-health/abundance-of-fructose-not-good-for-the-liver-heart pubmed.ncbi.nlm.nih.gov/20102774/ n.neurology.org/content/88/16_Supplement/P3.090 pubmed.ncbi.nlm.nih.gov/6859089/ www.ncbi.nlm.nih.gov/pubmed/10232622 www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/ www.ncbi.nlm.nih.gov/pmc/articles/PMC1413655/ www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/www.ncbi.nlm.nih.gov/pmc/articles/PMC8470960/ europepmc.org/article/MED/22402737?javascript_support=no pubmed.ncbi.nlm.nih.gov/2518860/ www.ncbi.nlm.nih.gov/pubmed/24905167 www.ncbi.nlm.nih.gov/pmc/articles/PMC6526871/ pubmed.ncbi.nlm.nih.gov/31890243/ www.ncbi.nlm.nih.gov/pubmed/25686106 pubmed.ncbi.nlm.nih.gov/21410865/ This list compiled over years of research by the user known as Pottenger's Human on youtube. Feel free to copy and paste this anywhere you like, no accreditation needed! My community tab will always contain an updated version of this list of fasting benefits. I also have playlists on fasting and health topics.

Money, money, money

And not for the first time. Look at all the pharmacorporations that have already been sued. Pharma and chemics aren't the most trustworthy companies..

Absolutely.

The rest of us thank you for exiting early.

so that means you have never got the polio vacine either.

All or nothing is almost never a good position to take. The jab did not live up to the word vaccine. In limiting severity of disease, to include fewer deaths, it was helpful. Side effects worth considering? Yes, of course. It did not slow or stop disease transmission in humans or at laboratories in Wu Han. That goes contrary to all previous vaccines.

Never again!

After 2020 I am suspicious of drugs too not just vacs

Exactly

The truth

That is absolutely right!!!

And here in Chanada we have the persecuted Convoy Truckers to prove it.

Yes!

Yup. I was mandated.

I agree with you but they didn’t actually mandate- our government did. And they need to be held as complicit in this.

Exactly!

ABSOLUTELY!!!!!

Precisely.

How exactly did they not expect this very obvious and recent trail to be traced?

Fortunately truth catches up sometimes it just takes a bit of time

Probably not enough jail space

Dr.Burke was executed by firing squad at gitmo and replaced by a clone..The Dems.needed Dr.fauci more that's why he's wearing 10,000 suits and has more security than the president..His time will come..

@@Msagstar UK government needs to pay compensation to victims..

The anti vaccine nuts who committed crimes against humanity by spreading misinformation that kills people.

No one... Just some under the table payoffs as they're "punished" with probably a few tax increases... Which they can just find a loophole around...

Don't forget the doctors who promoted it and pushed it onto people

Both. The underlying nexus between the WHO (not the band), Gates, Fauci, Pfizerman and his squeeze, the Biden Crime Syndicate and the Pfizer funded media,needs total reconsideration in the light of recent events. It boils down to: Drugs for what? For health? Or for profit?

I hope the doctors sue them

I was forced to leave my job of 22 years 😡

​@lsmith495 if you left your job, but still have a clean bloodstream, then you can rest easy. You will be a survivor, while the righteously indignant will all be gone soon, if not already.

Well said.

🎯🎯🎯

Financial change behavior to those who took it

How sorry is Campbell?

....While they prepare for disease X. Yup, Yup Yup!

Fauci and ppl like Anderson Cooper were paid millions to push the vaccine

Exactly.

The drug companies will be the fall guys. My research has shown me that it was made to order..

​@@joetodd4351 it was made pre covid

But so did John , even urging pregnant women to take it

It matches their brains 🧠

Money can make people do anything. When they have no conscious

Deeply sorry means nothing to the pharmaceutical group either.

Davo here from sunny beautiful Australia. I want more people to become aware of the three words I learnt during the covid fiasco. PERFIDIOUS. ASSININE. Non SEQUITUR. Check the definitions,and lock them in ready for the next bit of BS you hear from government,the media,big pharma or your "doctor" 😊.

Pfizer can't be sued the Governments of the World gave them immunity. People en mass who got jabbed should be suing the Government.

@@royferguson2297 You are correct! But , sue the government? Good luck with that .😬

Words r cheap especially words of liars n thieves

Not gonna happen. There's nothing left to lose for my generation. And the "invisible" stones thrown at us, may on some point be one too many.

good one you i refused the jab too.. yet seen my friends have blood clots and die after having the jab..

My husband and I refused the masks and the jab too pure bloods baby!!!no sheeple in our house

That means they will get out , Sorry no Amnesty this time!

@@karlg2950 they will...just not in this realm of their existence..

Probably somewhere around 1/3 of humanity

The senior executives are probably people with business degrees. With little understanding or no backgrounds in epidemiology, vaccines, human biology, statistics, clinical and non-clinical trials, etc. You let people like that run a high-tech, scientific or engineering company, you would get bad outcomes. Just ask Boeing.

Including the government and scientists who were on tv every evening.

AND CHILDREN 🤬

Still mandated in USA for medical staffs!

​@@jared1512insanity at its finest

@@Freedom-8910 it's in all the chdhood vaccines..all mrna

What? And waste even more of the taxpayer's money? On top of all the backhanded to Boris's mates for out of date PPE.

@MarkenstineGreen Now what did you call those people saying to not take it? You got what you deserved.

@@OIllllOdamn… you took the words right out of my mouth 💯

cheap talk. Their actions speak louder than words.

And the media!

They were all in it for benefits in one way or another. Shocking where is for the goodness of our fellow man.

And why now, after they all entered in a Faustian bargain, they will do everything to cover all their arses. Not one of them has a shred of moral responsibility left.

Nobody will be held accountable. Nobody in the Epstein/maxwell case. She’s probably in a mansion off a lavish coast. Diddy won’t be held accountable. Pfizer will not be held accountable and neither will Fauci. We’re merely tax paying slaves. Voting isn’t real.

They all probably had stock in big pharma

Gallows

Don't forget to include the businesses and bosses who coerced employees into getting it or they were fired. They need to be put on trial as well.

Give them all the vaccine and every booster. They’re safe, right? Why not?

Nobody was forced in the Uk. However if you’re elsewhere you have my deepest sympathy.

And employers

People lost jobs, bank accounts and more.

Others were not vaccinated but were still poisoned. It seems like the flu but it is not.

Those of us who wanted or needed to trade were FORCED to take it.

I lost everything, career of 23 years in health and social care, sacked after working through it all and not given a s**t about, everyone had a choice, you either had a backbone and said ‘no’ v simple or succumbed to the absolutely ridiculous amount of pressures and propaganda and brainwashing from every angle, I was even called a murderer after looking after the most vulnerable in society for over 2 decades, trust in any government or medical industry and many others infact are dead, done, over, as if they weren’t to be trusted in the first place……….yr health and wellbeing and morals and integrity are priceless, obviously many live in the controlled society built around them, that’s on them……

I was told that I wouldn't be able to get my suprapubic catheter changed if I didn't have the vaccines. They had already erased my care plan once and left me with no care at all.. I have to have a potent bladder washout every week and my catheter changed every 6wks, sometimes sooner if I have an infection, all at home by district nurse. For the first 3 months I was left with nothing. I cannot do it myself due to the after effects of a small stroke in Dec 2019. That and Neuropathy (due to over 20 years of Ciprofloxacin use for kidney infections as I have complex kidney and bladder issues). The combination makes it hard to use my hands and I physically cannot do it myself. Since the vaccines I have had 2 more small or mini strokes and the Neuropathy has caused a torn rotator cuff tendon in my shoulder, affecting my hand. I already had high BP and intermittent arrhythmias, since the vaccines these have got considerably worse with exhaustion, repeated arrhythmias going on for much longer episodes, breathlessness when talking, my sats go down to 70/75 when talking so big difference. This then leads to dizziness and falls etc due to lack of blood oxygen... I wish I had never had these damn vaccines, but I would have lost all my NHS care yet again if I had. Luckily we refused them for our daughter as by then the side effects were becoming known.

who is going to run the courts and be the judges

​@@eisbeinGermanyexactly! Can't trust the judicial system....in any country 😡

Definitely effective but not safe

The WHO still parrots that claim. Still on their website.

YEAH-- A TOTAL LOAD of stinkin' Bee Ess!!!

What were they charges with?

What if Skyrim Alchemist shops sold potions with "unintended side effects"... All ill say is some NPCs wont be living long in that perdicament

In the name of the devil.

Yes, you are correct. The ugly truth is that it's all about money for them. They will do anything, murder, cheat, lie etc for money!

It's Nurse John

I bet they are sorry that they've been caught.

@@jodiknight2820 What do you think this apology is for?

​@@happytwolaffs6454 is a doctor though... Has a docrate..

Teason?

Not just equally but mostly. IF they took more journalistic care and morale integrity they could have questioned this all at the start but they all chose to go along with it.

@@robanzzz5124 I haven't read a newspaper since then, they all showed their true colours and how biased they were, not to mention, totally unprofessional.

Seems like you think they weren’t bought and paid for and just didnt bother asking 💀

@@jrm7197 Oh definitely bought and paid.

@@jrm7197 they're journalist and could have exposed both sides of it but chose not to and no that's not what i think, i've been in this game longer than you buddy.

join class action for opiate crisis

Whenever possible, I will ask for generic or alternative.

@@miguel-jesus what junk of theirs do you need?

@@botfantasies6229 For my prescribed meds, I am know choosing another store.

Cue the turbo cancer medication

Just Pfi$er? You're kidding right? Take a look at the recent list of pharma settlements, for failing to report safety issues on their unlawful drugs. All the big names are there. And on more than one occasion... GlaxoSmithKline $3B and $750M, Pfi$er $2.3B and $430M Merck $650B, AstraZeneca $520M and $355M, JohnsonJohnson $2.2B. These 'drop in the ocean' fines will be seen as collateral damage. It's happened before, and it'll happen again. You think anyone cares? Yeah nah.

no they are only sorry they promoted the jab before it was allowed to be promoted

It was about misleading on social media, that's probably as good as we're going to get.

Janine Small admitted it publicly in front of the EU Parliament.

😷 There will be NO accountability and NO punishment. Remember that governments worldwide granted covid vaccine suppliers Pfizer and BioNTech indemnity from any claims that may arise from use of the vaccine.

Paid well by the corrupt federal governments.

Highly Profitable $ MANDATED SALES & Government funded... Are you interested in which USA NIH & CDC leaders owned Rich amounts of extremely profitable stocks $ ?

Sorry, as in wiping their tears with dollar bills ?

Not sorry enough. They can be sorry, but unless they are held accountable they will do it again and 'feel sorry' while being richer.

"And they would not repent of their pharmakea"

Fake wars, fake vaccines, fake sugar, fake people - it´s everywhere....

Of course not. They knew this would happen, but you know, you can't just say "Haha in your ass" to the public

Well said & spot on holiday.

Met all the goals.

@@thominaduncanson7596billions is the goal

Where is Gates, Tech execs, Mockingbird media, and WHO loud mouths!

And that’s just the result of Johns misinformation and anti vax grifting, Lol

Same here. It's because we have different laws about this stuff and sadly allow more than the uk does from pharmaceutical companies.

@@rachelgr8584we're the only country that I know of where sick people are traded as commodities for profit, with pretty much all related companies being publicly traded in our stock market. Our elected officials callously allow sickness and death to provide value to shareholders, who receive political donations from them. Our news media lies about things many of us are doing to stay out of the claws of the medical profession, by using studies that are anecdotal, not clinical at all, to scare people into stopping them from taking control of their own health, and use prescription drugs. Of course, there are lots of drug ads funding large news media companies. Not being able to afford basic healthcare and dying means absolutely nothing to them. Those in power are literally willing to allow us to die for their unsatisfiable lust for money. I haven't followed American news in a long while, because they hide stuff from the public that will help us thrive. Thriving will keep us out of the clutches out of the powerful, which stops the monetary windfall from flowing to the very rich.

They also need to stop brainwashing doctors who end up prescribing these drugs and regurgitating whatever they're told. "Oh, well, yes, there are risks with these medications, but they're on the market so they must have benefits." Sure, thought-sayers!

Can we assume the same applies to the US and the rest of the world???

Not just distributing, but developing!

The problem is, some medication can only be gotten from this company. If we ban them, lots of people will suffer or even die.

Should be deeply in jail.

So sorry for all you suffered due to this mandate, and I wish you well from this point forward. May we all be healed from this madness.

Nurse and doctors guilty plus anyone had power boss in factory leader in hospital bla bla

I left my nursing profession of 20 years rather than take something my clinical judgement could not possibly endorse or allow. Thank god I had a plan B. I view my complying colleagues as a collective of cowards though. Their clinical judgement would have been no different from mine, and had we as a collective stood our ground the madness would have been stopped in its tracks. That day. So yes I feel for you ... but there must be some acceptance of complicity ... like it or not ... 🌹🌹

What kind of surgery did you have, if you don't mind me asking?

I hope that you can recover.

Thank you. Appreciate it. Had 3, no more!!

Only the peacefull ones, those who threatened me nope.

​@@Marijan-fg4mdthey were thinking, that they were right. So many are regretting. It was "invisible" stones thrown at them. And they chose to pick them up and continuing the cycle. Prayer should be for everyone, even our worst enemies, and yes the criminals should be held accountable. But some never will be, others who are innocent get into prison. I am not trying to schoolmaster you. Only hope that the cycle can be broken.

It's madness, isn't it! Pregnant women advised not to drink, not to smoke, not to eat raw eggs or soft cheeses, caution with certain medications, but hey, queue up for your covid jab.

It's maddening!!!!

Same in the states.

And to patients about to undergo major surgery. lung removed, diaphragm taken out, spleen removed and the lining of the heart replaced. Why would you worry about getting the v I r u s and yes had the jabs to save sick parents.

​@@VL-qy4fcyep, but ok to vape

I thought making money is always supposed to be more important than saving lives right …?

So sorry you can't get an organ transplant unless you're "current ". So sorry it's part of the childhood immunization series. So sorry they're developing a self-replicating version for future " pandemics." So sorry they are now profiting off of the people who are now seriously ill. When are all madantes revoked?

That's the problem. The dopes didn't make billions. The blew it. All of it. Their stock is in the tank (been there for over a year) and have NO promising drugs in the pipeline. Disgraceful. In a normal capitalist market they would be bankrupt.

Unfortunately I think this is true

I totally agree! They were totally CRIMINAL along with the Gvts, all media outlets, Celebrities etc who all promoted this poison for a kickback! Talk about a new age HOLOCAUST!

♥ ♥ ♥

Like Europe. They have millions to pay ……

Russel Brand recent expose very unsettling..

You are quite deluded.

​@@papat7435please please get your booster

Even the animal trial of 30 ferrets in 2014 . they all died within 3 years . thats when they knew the vaccine was a success .

They are stil on poisoning duty. They are sorry for not given the bribe to this agency.

So sorry, Kevin. I tried to warn everyone, for 6-9 months on this podcast. Finally, Dr Campbell decided to do the research and was shocked with his findings!! Many were duped by governments and big pharma!!!!!!

So sorry Kevin! I tried to warn all on this podcast, until Dr Campbell did the research...

So sorry Kevin! My reply keeps getting deleted??

I am so sorry to hear your story. So many people are in your situation and it's so unfair.

I will pray for you and your family.

For crimes against humanity, especially one of this magnitude, it won't be life in prison, it will be execution. Nuremberg 2.0

for an advert on Twitter... hate to see what you think an actual crime deserves. you cult members do love hysterical reactions.

and all money should be returned.

Agreed.

Instead they are being celebrated at university functions (Fauci)

Only for getting caught. That's it.

And greedy sociopaths are the worst...

Nor are NARCASSISTS , or psychopaths .

Everyone that works there must be a sociopath, everyone except the janitor and door man.

Donald Trump.

Same.

Same here…no vac…got covid, has flu like symptoms for 4-5 days..but guess what? I survived!

2 million people died of covid. Does that not worry you even a tiny bit?

RIGHT ALONG WITH THE GOVERMENT WHO ALLOWED IT

legalised bribery & corruption

It is corruption.

And people in power with double interests. Ursula Vander Leyen's husband is in gentech. And she ordered 1,8 billion vaccines from Pfizer without a debate in the EU parliament or its approval.

tbh no medical company should be listed on the stock exchange. Profits shouldnt be associated with health. Not saying the business can't make a profit but shouldn't involve the pressure of pleasing shareholders.

@@Truthseeker-iz3dj Total reform is obviously needed. Unfortunately some very cowardly and immoral people would rather die of ignorance and lose their freedom, than admit that they made a mistake. that is how deeply embedded the sat£nic cu$lt has driven narcissism in the world. It is extremely biblical!

👏

Them outlaws are not sorry at all

United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats?? Military created the poison. Depopulation !

Me too, I’m with you on that! ❤️😊

same, the pressure was huge. lost some family membrrs along the way but hey, fuck em.

​@@Van-Cleef-b7mBot

@@lisac1619 he is in survival mode.... probably spent his career in the sciences or pharmaceutical fields. his belief is crashing down but his arrogance and stubbornness is all he has left to cling to.... hopefully they will get a vaccine soon to help people like him/her ;)

our governments certainly don't want to, unless a tony blaire figure pops out, demanding lawsuits for those who have gotten hurt or worst.

It is almost impossible to boycott them. They produce chemicals used by almost every industry.

@@kylegrace4718 They made one. It's not helping him but its helping us getting rid of him. Not many left like him so its working quite fine.

​@@Van-Cleef-b7mbye bye bot!!!

​@TORY-BLUE prove it, or it never happened........

​@@Van-Cleef-b7mGo get more boosters. You can have my share.

@@Van-Cleef-b7m What number you on? 8? 9? Yeah they work so well, it’s not a vaccination either, yr a liar 🤥

It is mind -boggling.

We must forgive others. Remember, our Creator said "Vengeance is Mine, I will repay."

@@AliciaLovesYAHUSHA I hope this kind phrase will not be used in courts as an escape goats for the hardened criminals in the future.

Well did you forget the other lawsuits in their shady past? Must have.

@@Mouse73 You're clearly haven't been paying attentions lol

​@@truthseeker4740 the forgiveness shes talking about (from the Bible) doesnt exempt someone from the consequences. Its more about _our_ souls and mind.

And make it all compulsory.

According to Dr Campbell, the west has signed over it's sovereignty to the WHO since March 2024.

@@elizabethfermor344getting injected while being restrained

PHE > UKHSA

May 25th it is the date. God have mercy on us 🙏

it's the great reset.

​@@tripzincluded8087supposedly it happens every 138 years according to this man whose channel is called Archaix I have not gone through all his videos but he has a mountain of data to back up his claims...but from what i have seen it is worth checking out.

Im sure I read somewhere that the owners of the 'shop' were all Isnotreali?

Bingo!

@@rozalynanderson8387 yeah ..its a common theme,,,you wonder who would be that callous? he chosen ones... we don't matter other than a resource to be managed controlled and exploited.... rewind repeat.

They will be sorry when they stand before their maker. Wouldn’t want to be in their shoes.

Exactly

If we get the politicians on our side it might happen, if we want the politicians to go down with them, nobody will be going to prison.

Yup let’s just shut down drug companies who, you know, make life saving drugs.

Unless an example is made this will happen again ! People died due to government propaganda and poor medical advice. Covid was a scam on an epic scale that killed l a lot of loved ones ! man made hell !

If politicians weren't involved, this would happen but they are joined by the hip.

But the top people are part of the global elite, so that's not likely.

What would happen to anyone who produced anything that caused death or so ill they could work no longer? "Safe and effective"? I guess that would depend on WHO is benefiting. This has been done frequently for years in several areas such as cribs that will keep babies inside them but no mention that baby might get their head stuck between poorly spaced (rails? I don't know the correct term). What about the melamine added to pet food which caused the death to family pets? It was added to increase the protein level! There's a long list. How many still think pesticides are 'safe and effective'?

My son is ill after second dose Pfizer since Feb 2022 !

Eeeeeeexxxxxxxaaaaaaaccccccctttttttlllllllyyyyyyy !!! ! !!!

I don't I have no sympathy whatsoever

Yes everybody who took the Pokie is somebody's family member

Me too, family and friends

Same here, 68 yrs young and have never had any kind of jab in my adult life, when this vaxx hit here I warned all family and friends, most listened but my 61 yr young brother let the fear get to him, he did the dirty deed and is dead now,his heart was " shredded"!

They are sorry that they got caught

@@Alice-vc3hjI was going to say that, same with the Post Office

Hung

of course their not its just words

It costs us too much - I have a better idea....

17 million an climbing 😢

My dad and some elements of our family died to this. Dad took Pfizer, then started manifesting symptoms, got a heart attack then clotting and multiple organ failure. He was a very healthy man!

not yet anyway. I will weep with joy on that day of accountability or public apology.

@@1cyanideghost Sorry to hear about your Dad. 🙏🏼 Most of us won’t forgive or forget the crime against humanity.

@@1cyanideghostsorry to hear it. My husband was diagnosed with cancer after the Pfizer booster. He is still around though.

😭❤✝️🙏

Sad and necessary post. Well said. There will never be forgiveness here.

Cupid Pokie 😉

Most of that was completely OUR EXTREMELY CRUEL GOVERNMENTS and HEALTH AUTHORITIES FAULT!

To forgive might be divine but right now it would feel inhuman. Perhaps we need consequence and contrition first.

That's a parasitic worm, not a snake.

Talk of flat earthers...

Ppl are still taking these damn shots🤬

Isn't that the truth! They flattened it pretty easily with so many voluntarily lining up. I still can't believe how many did without any thought.

@@cynthiarice7438 😳🙄😬 wow what the f*** is wrong with people???

@@MsMickey541 I know eh??it’s like they can’t use their own brain to think ummmm something isn’t right here ?! 😬🙄

The fact that there will be no consequences just shows what a double standard of justice now exists on both sides of the pond.

But they did say that they were sorry, so that must make it alright🙂

elected officials as a starter for 10

No one.

None of those responsible that's for sure