Cleaning KITCHEN of HOARDED HOME - how trauma can lead to hoarding

  Рет қаралды 111,876

A Beautiful Mess | Extreme Cleaning

A Beautiful Mess | Extreme Cleaning

4 ай бұрын

Meet Julie. Julie has had a lot of trauma in the past few years which has triggered some hoarding. She grew up in a hoarded home, but actually kept a clean and tidy home for the most part up until a few years ago when she had multiple traumatic events occur. Hoarding was one of the ways she dealt with the trauma. Find out more about Julie's particular case and even hear straight from her some of the things that she has been struggling with.
This is the first in what will be a series of videos of this home as we go through and declutter and clean different areas of the home.
Amazon affiliate links for some of my favorite cleaning products: (I make a small commission when you use my link)
Barkeeper's friend cleanser
amzn.to/44Veo2a
Microfiber cloths
amzn.to/42G0U8W
Ultra fine microfiber cloths
amzn.to/3QF21ky
Mr. Siga detail cleaning brush set
amzn.to/47e7N30
Bathroom Crevice Gaps Cleaning Brush
amzn.to/3Sr7aPd
Wire Brush Set 3Pcs
amzn.to/3RPWEzx
Steel scrub sponge
amzn.to/3SK2vIH
Krud Kutter Kitchen Degreaser
amzn.to/3RJsfTD
Razor blade scraper
amzn.to/3IcCuM6
Tub Tile scrubber brush
amzn.to/3o5vNES
Dawn Platinum Powerwash
amzn.to/42ZyfM4
Clear Storage Bins Stackable Plastic Containers for Organizing, 8 PACK Multi-size
amzn.to/3SsUCHj
Mr. Clean Clean Freak
amzn.to/3SJo3p3
Zep Oven and Grill Cleaner
amzn.to/40HRE45
Super Clean Degreaser
amzn.to/3qQQjKs
Scrub Daddy sponges
amzn.to/3o2ip4e
Scrub Mommy sponges
amzn.to/41JlXWW
Scour Daddy
amzn.to/3W4RMsa
Floor squeegee
amzn.to/3MtrsEG
Mr. Clean Magic Eraser
amzn.to/47B504n
Magic Cleaning sponge
amzn.to/3Oo3EmG
Easy Off Oven Cleaner
amzn.to/3pOMzIE
Kaboom bathroom cleaner
amzn.to/3sKXkO4
Swiffer
amzn.to/3OgnC38
The Pink Stuff
amzn.to/3pHDZvo
Broom and Dust Pan set
amzn.to/3MukMq0
Baking soda
amzn.to/42FDCjz
Libman scrub brush set
amzn.to/42D2aKd
Weiman Stainless Steel Cleaner and Polish
amzn.to/441AM9v
Sprayway Glass Cleaner
amzn.to/3Xe6i17
Liquid Gold Wood Care
amzn.to/3pDKSya
ALTRA Women's Trail Running Shoe
amzn.to/3Oi54zl

Пікірлер: 788
@DonnaStocking
@DonnaStocking 4 ай бұрын
Bonnie's mom here. This has been quite the project. I'm glad I could help my daughter clean.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Me too! Thanks for your help, mama!🥰😘
@kateavedissian3273
@kateavedissian3273 3 ай бұрын
You are amazing! I miss my mama. So glad B has you!
@johnkelly9451
@johnkelly9451 3 ай бұрын
I can see where Bonnie gets her hard work ethics and determination from. Enjoy seeing you both help eachother and your exchanges together are just wonderful! You are an amazing mom and raised an amazing daughter! Thank you both for helping and helping the viewers too!
@carolynkuehn574
@carolynkuehn574 2 ай бұрын
Yidikkddkkhhdkohkdkkkkdoofssgkgsigohsghogkhskhohhodhgofkdosohodhffgff GG fkahgafkaddkoododoofddjo hohosgoakagaoaaghhagadgkh ggodhkodkgsooafkahhjdohagoahaohaoahohaoaogadahgoaahogahgoaogahoahhaahahaahofdjofajahaodhajaofafoaogaodhaosfoahoakhofoofodododokdfpfhaafjafkjkdkdkohojkoajdogsjdaojdookgsfkaosfagofaaha GG akokojogoaohsfaohfoadjaoffaoddoahhaoagoaogafoaogdoaoahogoffooddoahogahdofhsjjdojghaaahgjaofaodjohahaofagoaohsgoadafodakaofofodododkfahajsajdododdkghaksfajgoskgskodosogfasdooogaodoaofdoaohfoagofakaohodfoajhaohaahahfoadoofahodhaodadadoofooddosojakfkkkkhjsgakdoor-to-door haha of an of half ad gfhaaahafffa GG fhaffgggohgjsjsjsgggofohagoogagogggggjsjsjsujsgigggofodogggggggggggodoggsogooggʻggjsdsjfgidggofodoooggooggogggʻhaahaafhaf GG fffffggggghaaffffffffafjfggg GG ohhsjsdfoggdog ft ggodogodogoooooiisoododgofofohahaaf GG faffoffgggggg GG ggjdigododgofooggʻgf GG fgaaaaaaghaahaahPapagpaaagajjsjgaHsgaaidisjidofaajodhaosodajfoagohaahagaajaaahgaajsjsajgaagasJhahhagajagjsoahsaaphaohhaoasgsjjsaGhaaadaahajsuagapajfpapjaaaaugaoaahhshaoaahahgaHgGAASFougahidfoaaooapagaaahfaGaaaaajsshaagaaaaaaaaaaaaaaaaaddjsaaahahahgaaaaaa GG GG aaggaggaaaaagaahaussaagasagaiaahgagaofaaaaaidosgaoahgoaaaahsaahausgaaaaaaaagaaagaaaaasuuahuFihaisusiahhishahaahushaGhausgausagSsgKrxsfoaofuagaaaaaausgaaahaaaaaaaaagagaaaausgaugagagausgaaasgaafaugaugagaaaahahaaaaffgaffusgaggagagaagghadaushsigaishaahaahasaoggooagaaaaaaaaaaaaaaaaaashususgaisigaaahgaaaaaoaaofaoougausgaaaaaaaauahhaaaaafaagasgaaaagaasgaaaagaaagaaaaaghaahgaff GG fhagaaggagofgaaaausuiidhaadihisahohagaaaahaodihasaagaaaaaausautahgaaagaoaogagaagaagagagaagaaaugaàagafaaaaaaaaaagaaaaaaaaagidgaauggaaggagaaaaaajsgaagoosgaooaouggaagaagaaggagaaaaaaaahahaaihaususifahaifihaFhahaaausofaaaidqidagaaaaahgaaaaagaaggaaaaaaaagaaaaigaaaaahafhaf GG gggaoaaajsgajsgsdihadiodoiofaaagafoaoooaoaoiggagaagaUusgDFhafojsgojogóiruofoififudfifgidgidifdyggifiddidfdhofhofgffhirrugrgirhirgrhtiuirrhrheuuuoeuuuoruurfruofreuirieirgieigeueiegifyififgruofuuigidgidofujoejjhduogidfufuofidudidfidudiffdfuidfoufuidddiddgdgidididididididdhididuiduofduuiddudidhiduduifididududidudididggggiuirirttourtyouuùùuuuù9yu9y9uùùotu9yu9yùuy9ùotu9yu09yu9yu9yuu9yu99yu9y99ùu9y0uout uuuùùùùù9y99ui9y9yì9yi9yu999yuìiiiì😊ù8r9r999tt9t9yup iruu I tr​@@kateavedissian3273
@kristinehuggins4389
@kristinehuggins4389 2 ай бұрын
I think what your daughter is doing for all of these wonderful people is so admirable. She quite obviously cares with her whole heart. I suffer from PTSD and a lot of childhood trauma that I’m working hard on with a lot of help and I think for me the one constant on my journey is the complete absence of any kind of judgement because in reality, no one wants to be at risk and now at 39 and having severe degenerative disc disease and 2 botched spinal fusions and more surgeries to come. No one chooses trauma. We all deal with things in many different ways but at the end of the day we are all humans. I absolutely love watching these videos for what your daughter does and you as well ❤ but it also helps to not feel so alone. Very inspiring all the way around ❤ you’re all a true blessing
@lisathurston8265
@lisathurston8265 4 ай бұрын
It was My Pleasure working with you. You are such a sweetie to help this person out. I would love to come and help more. Can't say thank you enough for the opportunity. Like Bonnie says please be kind in the comments. She really needs the help. She is a sweet and kind person. Send Love and Hugs Not negative comments. 💞😍😘🤗
@jonfen1657
@jonfen1657 4 ай бұрын
Mean people can just suck it. ;) You did a great job!
@keljo2041
@keljo2041 4 ай бұрын
You are a mega cleaning machine 😊 I’d want you to clean my house, trouble is I live in England ! Good job Lisa ❤
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thanks, Lisa! It was fun working with you! You're a powerhouse! We'll do it again soon!!💜❤️🥰
@Ilovebirdgag
@Ilovebirdgag 4 ай бұрын
you two have the golden arms
@cat-mum-Jules
@cat-mum-Jules 4 ай бұрын
We'll spin kick em out of the room! 😂​@@jonfen1657
@madzabinga8382
@madzabinga8382 4 ай бұрын
It never ceases to amaze me how a small group of women can come together and help change another woman's life for the better. This is the definition of Girl Power! We all need support and understanding from others and this was so wonderful to see. You rallied around her and lifted her up with your help!
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
🥰🙏
@Tobyszia
@Tobyszia 4 ай бұрын
People really criticize how you clean?!?!! Wow I’m always in awe of what you accomplish.
@leashy1204
@leashy1204 4 ай бұрын
IKR!!!!?💕🌟💕🌟💕🌟💕🌟
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Yup, it's weird. At least for every criticism, there's at least 2 to 300 other people who are very encouraging.😊❤️
@TamaraSanchez-kg2cd
@TamaraSanchez-kg2cd 4 ай бұрын
Love to watch you & listen to you explain the what, why & how of your process. In this video I loved that you had help. It's a lot to do for one person. Your mom is awesome. And, Lisa. It's fantastic that you gave her the chance to help a person also.
@angelarothbauer8096
@angelarothbauer8096 4 ай бұрын
I find it weird that they criticize- the whole concept of helping others seems to escape these people
@cherylkoski-pe8gw
@cherylkoski-pe8gw Ай бұрын
Me, too!
@catspyjamas7944
@catspyjamas7944 Ай бұрын
I’m one of those people who have a “trauma timeline”. Once things reach critical mass your nervous system basically goes into partial collapse. I actually started mysteriously fainting at random times without medical explanation. I almost had to give up driving because I’d be found passed out in car parks. Anyone standing in judgement of people like this lady have probably not walked a mile in her shoes, or they have had sufficient support around them that they were able to cope just enough to get through. I get it. The human body and psyche was never equipped to endure unending high levels of traumatic stress without periods of recovery. I’m doing much better now but my heart goes out to everyone fighting for their survival. Bonnie, you are truly a blessing to humanity.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp Ай бұрын
I agree with your statement about the human body and psyche not being "equipped to endure unending high levels of traumatic stress without periods of recovery." Very well said. I'm so glad you're in a better place and I hope "Julie" can get there. If you are just starting this series of her house, you will see by the last one that things did not end up very well as hard as we tried, but I'm still holding out hope she will get the therapy she needs to truly deal with this disorder.
@sherim132
@sherim132 4 ай бұрын
Im surprised how many perfect people there are in the world that they can judge people so harshly. I think its great that people like Bonnie, Mack, and Barbie and all the others have created a community to help people.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
😊❤️🙏
@annwilliams6438
@annwilliams6438 Ай бұрын
Also have a look at another channel in this circle of cleaning angels: Coline Cleans. She is in Holland.🇳🇱
@megwolff58
@megwolff58 4 ай бұрын
One of the most important concepts you mentioned and demonstrated in this video was the idea of compassionate "companioning." Three generations of women being present to help another woman who is suffering. It used to be common in communities, but not so much these days. I was deeply moved to see it in action again in this video. Thankyou to Bonnie, Mum and Lisa.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Yes, I'm learning that is a big part in helping these individuals. They need to feel listened to and understood before they can really trust you enough to actually help them. I think so often people would come in and just toss everything out because it's not valuable to them, but that just re-traumatizes the person to whom it is valuable to. It's sad that so often their voice has not really been heard.
@4455thor
@4455thor 4 ай бұрын
HUGS for Julie. Life is hard and sometimes we fall short. I stand all amazed that you were able to ask for help. And thank you to all of your helpers. Have a great weekend. ❤‍🩹
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Absolutely right. We ALL fall short somewhere. That's what our Savior is for. 🥰🙏
@4455thor
@4455thor 4 ай бұрын
@@ABeautifulMessExtremeCle-zl1wp I most certainly know how hard it is to ask for help. My clothing has been in disorderly heaps for AGES. But tonight we (my hubby and I) grabbed a BIG trash bag and filled in all the clothing that I no longer wear (nor do they fit), but they were too good to trash. So tomorrow my friend gets TWO big bags of clothing to look at. (And I told her another friends name who can take, what she can't use). It feels SO good.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
That's so awesome! It DOES feel so good!
@sarahlewis7820
@sarahlewis7820 Ай бұрын
seems this poor lady has had very little support, physically or mentally. you are an angel in disguise.
@NewJerseyLaw
@NewJerseyLaw 4 ай бұрын
Worth the wait! Bonnie, STOP! being so apologetic about yourself. STOP!!!!! You are a force of nature, as is your Mother. The welcome addition of your helper looks like the beginnings of an army!
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Was I? I actually don't remember being that apologetic in this one, but it's very possible. Still getting that confidence. Thank you for your kind words!💕
@mollybradshaw9336
@mollybradshaw9336 4 ай бұрын
True. Never complain, never explain.....no need.
@lauralaforge558
@lauralaforge558 3 ай бұрын
​@@ABeautifulMessExtremeCle-zl1wpyou're doing a million times better with the not apologizing.
@MsNdrstd1
@MsNdrstd1 15 күн бұрын
your mom raised a winner
@thechickincharge1073
@thechickincharge1073 4 ай бұрын
I would have to wear ear plugs to be able to cope with her incessant talking. Just what you've shown makes me feel total panic!! Just the talking, not the stuff. That is amazing that you do her laundry. You never cease to amaze me! As I've gotten older it has been harder to keep the amount of things under control, so I understand with trauma how it can consume. I pray this will make her feel amazing! Great job!!!
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Yes, honestly, all the talking was hurting my brain. 😬It has been better the last couple times I've been there as I have been working in the basement and more by myself or with one other person.
@intherockies
@intherockies 2 ай бұрын
​@@ABeautifulMessExtremeCle-zl1wp Would wearing noise canceling headphones (when the noise becomes too much) help? Maybe something you can try 🤷🏼‍♀️
@jeanchecefsky3791
@jeanchecefsky3791 Ай бұрын
Whos the other lady?
@hushhush85
@hushhush85 7 күн бұрын
@@jeanchecefsky3791 that's Bonnies mom☺
@LaToyaPlansLife
@LaToyaPlansLife 4 күн бұрын
I agree. Even with the video being sped up is driving me crazy 😮 God bless you for helping her ❤
@debralaforest9274
@debralaforest9274 4 ай бұрын
You and your mom are amazing and “Julie” is great for asking for help. As Mack says, even if they regress they had a period of living in a clean, orderly space. Such a blessing!
@Elizagrace9
@Elizagrace9 Ай бұрын
Bonnie, thank you for being so open in sharing the isses you had in school with your shyness. Your emotion in talking about this brought tears to my eyes. 😢 I know many of your followers empathize with you. That time of life could really be challenging!! Thank you for your work and service to orhers in need!! I love watching you.💖
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp Ай бұрын
Thank you so much!
@mariaalvarez8385
@mariaalvarez8385 4 ай бұрын
Your helper is a very good cleaner. She is a keeper. Great Job ladies!
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Agreed!!
@maryscott7685
@maryscott7685 4 ай бұрын
I appreciate the way in which you handled this cleaning. Hoarding is a very debilitating mental health condition.
@tracymarierobles4471
@tracymarierobles4471 Ай бұрын
I like watching videos like this where people are helping other people clean and declutter their homes. I feel I get inspired to clean and declutter and organize my own home
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp Ай бұрын
Thanks, Tracy! I'm glad it inspires you. 😊❤️
@bonnieknighton7296
@bonnieknighton7296 4 ай бұрын
It's amazing that there are people who take time out of their life to watch an entire video and then make the effort to craft a snarky, hateful remark. Who has the time for such negativity?! Oh, they didn't actually watch the video? They just scrolled, saw a few seconds with an imperfect situation, made a snap judgment, and then allowed themselves to feel superior by leaving an ignorant uninformed comment. Well, I am not sure who I pity more, the person who hateful or the ignorant. Well, it's not the home owner because she's got Bonbon on her team! Great job Bonster and great job Home owner, so proud of you both.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Yep, you described perfectly the type of scenario that I envision when people leave negative comments. I never feel bad for deleting those remarks because they didn't even take the time to watch the video and I can tell from their comments. So...buh-bye! 😊
@dweamy1
@dweamy1 4 ай бұрын
I really admire you, I would not know where to start ! Thank you for helping Julie.
@marybedy9760
@marybedy9760 4 ай бұрын
Had to pause this one twice - once to dust my living room furniture and once to clean my entry way floor. Thank you for getting me off my behind! And thank you for what you are doing for others. You make a difference.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
That's the best reason to pause a video.😄 I love that it motivated you! I also will put on one of my favorite cleaning channels while I am cleaning to casually watch and listen to because it helps to motivate me. It's kind of like I'm cleaning with a friend.🤗❤️
@johnkelly9451
@johnkelly9451 2 ай бұрын
I carry my phone around with me while dusting room to room while playing cleaning videos and set phone on mantel, hutch ect... great company and motivation and get to watch in between dusting pictures and knick nacks ect., folding laundry, doing dishes, ect. , I end up looking for things to do to finish a video! tks Bonnie! (Mack, Barbie, Mira!) (Coline too!) You each have your gifted Super Powers that motivate us, but you are all incredible making the transformations happen! Gives us all hope looking at our weekly, daily, monthly, yearly messes and awesome cleaning tips too!
@CaroleCanada
@CaroleCanada 4 ай бұрын
I think it’s so important when the homeowner is involved with the cleaning. You all did such a great job!
@SandraNelson063
@SandraNelson063 Ай бұрын
I send hugs to Julie. I've been there. Its hard, but she'll get there.
@emaleighadamslyle9099
@emaleighadamslyle9099 Ай бұрын
I don’t think it matters how you choose to clean as long as the outcome is the same, there may be faster methods or methods that are better for the enviroment but for messes like this… as long as it gets clean and improves the owners quality of life who cares how you get there. Thank you for being so willing to help people clean up their homes, I’m sure it brings them such relief!
@MickeyC321
@MickeyC321 4 ай бұрын
Great work! The “trolls” will find their way to try to spoil something that is working. Such sadness and ager resides in them. BUT, you rise above them because, they will never understand true goodness.keep on keeping on. I understand completely working quietly. It’s therapeutic and calming. You are wise to accept help in certain situations in order to get the job done. Bless you.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thank you! I think next time I work there, I'm going to try to pick an area to work on with some earbuds and music on because I definitely have had a lot of anxiety with all of the constant chatter while working there, but I knew it was kind of necessary especially in the beginning to have that much help and that much input from the homeowner, but now that I know a little bit about what our goals are, I feel like I can work a little bit more on my own and get a lot of organizing into categories done.😊
@conniezepszeps2535
@conniezepszeps2535 4 ай бұрын
Bonnie you and your Mom are so kind to help Julie, she will remember you forever! Not many people would do all that you did for her. The world is a better place because of you and what you do.
@rhondalockrey9592
@rhondalockrey9592 4 ай бұрын
It must be so hard for people to reach out for help but wow would it be life changing for them to have a fresh start! Fantastic job as always!
@wendyduwe3995
@wendyduwe3995 4 ай бұрын
Loved this video. I think Julie is so brave to put her life out there and to face her trauma. Julie if you read this, you are making progress. I am so glad that you are taking control of the trauma. I struggle with depression and grief. On bad days I give myself 5 - 10 minutes to feel my feelings and that is all I give it . It is still deep down inside, but I am able to function better than I could before. Love and hugs.
@colinecleans
@colinecleans 4 ай бұрын
Wow, Bonnie! You really upped your game with this cleaning! What a tremendous amount of work. 💪The living room looked so much better. And you even did the laundry! 🫶 Your mom has such a young spirit and a loving heart!! 🩵 I hope Julie will feel a sense of relieve after this. 🩵 Love X Coline
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thanks so much, Coline. 💜I think we wore her out this last week, so we may need to take a break this coming week and then get back to it. I certainly wouldn't mind the break either. This has been a big job. But I also don't want to lose momentum, so it's a tough call. I guess we will play it by ear.😊
@s-potter
@s-potter 4 ай бұрын
The seemingly subliminal “call 911” made me giggle. Wonderful job as always!!
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Right?!😄
@Stopthisrightnow560
@Stopthisrightnow560 Ай бұрын
I get irrationally excited when I see these houses.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp Ай бұрын
"Irrationally excited..." 😅 I love it!❤️
@innovativesolutions2428
@innovativesolutions2428 4 ай бұрын
God Bless you guys for helping without judgement.
@Cindy-cq8zr
@Cindy-cq8zr 4 ай бұрын
Wtg Mom! She was a great help! I miss my Mom everyday.
@susanseale6363
@susanseale6363 2 ай бұрын
thank you for helping those that haven't been able to help themselves but are brave enough to ask for help and start anew. You're truly a blessing.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 2 ай бұрын
Thank you so much!
@sellyourhomenowbook
@sellyourhomenowbook 4 ай бұрын
Only 1 minute in and i am standing up and clapping. Bravo Beautiful Bonnie.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Lol... thank you!😄
@NekoKaoru
@NekoKaoru 2 ай бұрын
Cleaning, even a small section of the room, makes me feel so much better. Even a simple wipe down or a sweep can be so beneficial. Thank you for your kindness to help others!
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 2 ай бұрын
Love that!
@faithsmith7431
@faithsmith7431 4 ай бұрын
Thank you all for helping this homeowner.❤
@kevinritchie9227
@kevinritchie9227 4 ай бұрын
It is very kind of you to help out 'Julie' so she doesnt lose her home. Its a shame some people dont understand this condition and can only be negative.
@carolineleblond3718
@carolineleblond3718 4 ай бұрын
Love what you do on your videos! Sorry if you have to read bad comments. Really sad that people are criticizing others… You make a huge difference in other women’s life and it’s what is important. Like to pass some time with you ♥️
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thank you, Caroline! 🙏💜
@karencaudill8148
@karencaudill8148 4 ай бұрын
I love how you spray the dishes and soak them in the huge totes.
@lisaschreiber2893
@lisaschreiber2893 4 ай бұрын
while I don’t really understand why someone would leave a hateful comment, I am super excited you are there helping her ❤❤❤ kindness is always so motivating
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thank you, Lisa.😊❤️
@jenniferjohnson7955
@jenniferjohnson7955 4 ай бұрын
You have a gift that you share free. What a joy you are to others 😊
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Wow, thank you
@patgrant3741
@patgrant3741 4 ай бұрын
You are so kind to help people get back on track, organized and in comfortable home. Your mother is also amazing to help you with this.
@angelinatesta3918
@angelinatesta3918 4 ай бұрын
Sad,lonely,isolated,my heart hurts for these ppl they surround themselves with how they feel inside 😢 I hope she feels better now
@katrinat7936
@katrinat7936 4 ай бұрын
Amazing job! As you said, it is difficult to understand hoarders, as it is a mental disorder, but it is great they can have your help!
@jenniferknowles7219
@jenniferknowles7219 Ай бұрын
One thing you can be sure of is that messy people or hoarders do not want to live like that. It’s just overwhelming and it’s hard to make decisions where everything should go. The clutter is part of their disorganized mind. (. Speaking about myself here. Not really a hoarder but very much a clutter bug. Also many work long hours and are exhausted when they get home.
@ErocasEclecticEphemera
@ErocasEclecticEphemera 2 ай бұрын
Never worry about the ones that criticize...you are doing great things...i am new to your chanel and i am binge watching as many as i can ...it motivates me to get my place done
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 2 ай бұрын
Oh, thank you so much! I'm glad you're here!
@toni5431
@toni5431 4 ай бұрын
Wow this is a huge overwhelming task to take on Bonnie. I admire you greatly for getting stuck in and helping this lady to recover her home whilst also retaining her dignity. She recognizes her problems and is taking the necessary steps to heal. I am glad she is accepting your help and not feeling like her voice is ignored amongst the many others. Maybe that's why she's so chatty with you all, because she feels heard for a change. Well done to you, your mom, your helpers and the lady herself!
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thank you so much!
@asheleybuchwalter9069
@asheleybuchwalter9069 4 ай бұрын
I know you said it doesn't look like you did a lot in that family/living room, but it really does! Also, I don't mind the longer videos at all! Unless they're harder to edit, then I totally get it. I can't wait to see the rest of the series, and I'm looking forward to the merch! If able, I think a super cute or sassy dishwasher magnet about clean vs. dirty dishes would be awesome. ❤
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Oh thank you! I haven't even thought of magnets in a merch shop. That's a great idea! Thank you for sharing that idea!❤️😊
@homeandgardendiy6363
@homeandgardendiy6363 Ай бұрын
While we're on the topic of merch ideas, you might want to use this one from my dear mom... "I just love work -- I could watch it all day." 😀 Thanks for all you do, Bonnie. Keep being you, and God bless you! 🙏🕊
@kellydevault7163
@kellydevault7163 4 ай бұрын
You are really a beautiful person. And a blessing for us people who need your help. God bless you.
@marinaroper6922
@marinaroper6922 Ай бұрын
I have a friend that has hoarding issues, she allowed to help her once when her older daughter was getting married and she wanted a small Gathering at home. I couldn’t understand her, but I remain quiet and help her. She did had a couple of traumatic events in her life. Thank you for helping me understand her better.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp Ай бұрын
Of course. It is a hard thing to understand and I still don't completely get it, but I'm trying.
@ruthiezophia7118
@ruthiezophia7118 4 ай бұрын
That was a cute jacket of her mom's. I'm glad she kept that.
@deborahallen5162
@deborahallen5162 3 ай бұрын
I give you enormous credit for being able to handle the chatter. I would not have been able to do it. Way too much stimulation for me. You are a blessing
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 3 ай бұрын
I was actually losing my mind a little bit with all the chatter. I had to make other arrangements the other times that I went over there to make sure that I wasn't surrounded by so much talking. It was kind of necessary those first couple of days just because we had limited room to work in and a lot of people helping, so just discussing how to do things was necessary. It wasn't easy though.😬
@prymodee6723
@prymodee6723 4 ай бұрын
Thank you for everything you do, Bonnie! I follow your channel for a long time and I watched you help so many people (including Mira from Peeling away the clutter - she is amazing!) and I'm amazed by what you do for other people!
@MaryEavey-dc3sk
@MaryEavey-dc3sk 4 ай бұрын
I like watching Mira too
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
I appreciate it!🥰
@alannahwatts5778
@alannahwatts5778 4 ай бұрын
You were so patient. That looks like a very long but rewarding process.
@ShettikkaWoods-jl8iq
@ShettikkaWoods-jl8iq 4 ай бұрын
Good morning 🌄🌞🐰🍵 blessings 💞🙏🏾 awesome 👍🏾
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Good morning!
@sellyourhomenowbook
@sellyourhomenowbook 4 ай бұрын
Lessthan 5 in and im loving the way you cleared a small spot and vacuumed. Already improved! ❤🎉
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Quick win!😁
@chenson7696
@chenson7696 2 ай бұрын
I have ADHD clutter mainly because I am now an antique dealer. I think we are addicted to estate sales. So much fun. But I love to see the results. Its wonderful to know there are still kind people in the world. God bless you. PS I just subscribed thanks to Midwest Magic Johnny!!
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 2 ай бұрын
Midwest Magic Johnny...LOL! Thanks for being here!
@debbysouthworth5606
@debbysouthworth5606 4 ай бұрын
Thanks to you she is taking down the physical manifestation of her emotional walls. It's never easy for these folks to do that after multiple traumatic experiences. And the subliminal 9-1-1 call was a perfect description of where Julie was. You and your mom came to her rescue. FYI-I noticed that she shops at Winco. They have barrels for plastic bag returns right at the entrance to the store. At least they do at my store.
@irenea2006
@irenea2006 4 ай бұрын
Wow, 72 years old. Impressive energy. Way to go.
@debbysouthworth5606
@debbysouthworth5606 4 ай бұрын
The thing I love about Dawn Power Wash is that a) it doesn't damage wood as it cleans and b) everything smells so good after you use it!
@rhirhimorgan8392
@rhirhimorgan8392 4 ай бұрын
So awesome. That oven now needs shades to look at now. So shiny!!❤
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
😄
@mollylindsay1825
@mollylindsay1825 4 ай бұрын
Feedback- just fyi the sped up voices is very jarring and headache inducing. I turned the audio down but then missed out on any voice over or when Julie was telling her story. Speeding up the video is fine, but not leaving sped up voices in. Thank you, Bonnie for helping this family! Love you and your mama ❤.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
That's the hardest part about this is figuring out what to do with those parts of the video because, I can leave the video sped up and mute the clip, but nobody likes it when I add music and I don't have enough to say with a voiceover to be able to talk the whole time. So, it's either just complete silence or I tell everyone to not talk while we are cleaning. It is a lot easier to edit video when I am just working on my own, which is why I usually prefer that, but I can't really do that with this house. Figuring out how to make videos that please everyone is so hard. That's why I apologized right in the beginning that there was going to be some sped up voices because I knew that was annoying to a lot of people, but I just don't know what else to do. But, thank you for the feedback. If I ever quit youtube, it will be because of the editing and trying to please everyone. I may need to take a poll to see what most people prefer...sped up talking, music, voiceover about something random, or silence. Or maybe I leave it at normal speed and have a super long video...or cut out even more. 🤷‍♀️I know I am way overthinking this, but that's what my mind does with feedback. I just want to make good videos! 😓 Time to create a poll...
@NancyJo-dr6mj
@NancyJo-dr6mj 4 ай бұрын
Unfortunately, I have to agree. It actually made my anxiety spike. But, I do love what you do. Great job!
@bellababooska4181
@bellababooska4181 4 ай бұрын
That looks great, she is very brave. I know how hard it is to let go of things , the panic inside. You're so strong to be doing this and allowing others to help. I wish you so much happiness. ❤❤❤
@jenniferknowles7219
@jenniferknowles7219 Ай бұрын
I think you have a super power in real life Bonnie. This is going to make the home owner feel great. When you have a messy or hoarded house it really weighs heavy on your mind and self esteem. You are very inspiring! ❤👏👏👏👏👏👏👏👏
@freedomforusa1658
@freedomforusa1658 4 ай бұрын
I use to clean, 9 years as a career, I love what you do. Keep up the great help and enjoy each day! :)
@leashy1204
@leashy1204 4 ай бұрын
I went to your channel and sub'd!! I want to watch you draw & stuff!! I love art, painting, collages, coloring, drawing, etc. So your channel looked liked sonething I might like!!👍👍💕
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thank you!
@AngusHenry09
@AngusHenry09 4 ай бұрын
Your mom is quite the go-getter, I see where you get it. Once again you and your merry lil band of helpers are doing wonderful, kind, caring things the Beautiful Mess way, love it !!! ❤❤❤ It was definitely worth the wait Beautiful Bonnie. This is that old lady from the live, Angus is my cat. 😂😂😂 Hope this lady can heal properly and go on to have a great life.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Oh, yes! I remember saying, "Angus?" on the live because I wasn't sure if I was reading it correctly because I figured you were female, and that just didn't fit. That makes sense now.😅 Well, I'm certainly not going to call you "that old lady from the live."😁 So, what is your name?
@Janneli2024
@Janneli2024 4 ай бұрын
I would love to here you talk about your cleaning plan like first I’ll pick up the rubbish then bag majorly of clothes etc great the owner is helping 👍🏻👍🏻
@LaurelChinnRealEstate-Fairfax
@LaurelChinnRealEstate-Fairfax 4 ай бұрын
I checked my phone 17 mins after you loaded. 😂. Glad things worked out and you were able to process the video.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Me, too. Thanks!
@mrsminiverblue
@mrsminiverblue 2 ай бұрын
Julie is a very brave lady facing a very difficult task. ❤
@diane7546
@diane7546 3 ай бұрын
Good Lord Hun. You worked and scrubbed your fingers off. Hoarding disease runs in my family. My Mother was a hoarder and her Mother was too. I have a sister that is buried alive. Alot of people don't understand the disease. I'm not sure I fully understand it myself. Thank God I didn't inherit that gene. I'm more of a "Clean Freak" since growing up in a situation like that. God bless all of you for helping this lady and her husband get some kind of order back into their home. You guys did some detailed cleaning up in there. 👍👍🫂❤
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 3 ай бұрын
I have decided it is up there with schizophrenia as far as one of the worst mental disorders. It really disrupts so many things and, not only is it usually caused by trauma, but it can traumatize all of those involved in the hoarder's life. I totally understand going the exact opposite direction growing up in a house like that and yet I also understand how that just becomes the norm and you just continue living like that. It's such a difficult thing to treat and so sad to watch what it does to the hoarder and their family.😔
@debby891
@debby891 4 ай бұрын
Bonnie, you and your mom make an amazing team! Great job as always❤❤❤
@LaurelChinnRealEstate-Fairfax
@LaurelChinnRealEstate-Fairfax 4 ай бұрын
Love mom saying…shouldn’t we put the stuff with tags on in a separate bin? She’s in my tribe. Lol
@LaurelChinnRealEstate-Fairfax
@LaurelChinnRealEstate-Fairfax 4 ай бұрын
Bonnie, I saw a cleaner use a pool noodle to fill her dish tubs. It worked! It’s like a faucet extender!
@debby891
@debby891 4 ай бұрын
@@LaurelChinnRealEstate-Fairfax 😂
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Aw, thanks!
@timetochange3002
@timetochange3002 4 ай бұрын
I’m almost 71 and I think your mom could run circles around me as the saying goes. 😂 in fact I have someone help keep my home clean every two weeks. Getting on my knees is a big deal lol. 😁Thanks for another great video and all your hard work getting it to us. ❤️
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Even getting on my knees is painful and I'm 46! She is having a harder time getting up from that position, but she's still doing amazing!
@kaceyharms3135
@kaceyharms3135 2 ай бұрын
I’m in Canada and I’m salavating over all those plastic bags.😂. They are contraband in our country.
@artcreationsbydar
@artcreationsbydar 2 ай бұрын
Boy you sure said it! I am from Canada too and can’t stand paper bags! But even worse, I have totally boycotted paper straws, and wooden cutlery! Once I start venting about it I can’t quit! lol I am all for keeping the earth safe but the whole straw thing , it drives me crazy! You get an iced cap from Tim Horton’s with a paper straw! Come on! Just ridiculous! ❤❤❤❤ Ok I am done! Lol
@themomvlogger1856
@themomvlogger1856 29 күн бұрын
Y’all helped this woman out in a huge way. Very admirable 💜
@dirtbagdeacon
@dirtbagdeacon 4 ай бұрын
Hey, at least with lots of garbage bags and boxes, you had plenty of places to put things, wherever they needed to go. Great work!!!
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Very true!
@nelliemccarty5625
@nelliemccarty5625 4 ай бұрын
I absolutely appreciate the work you do. I learn from watching and listening. My brain is a little different and you and Mac have helped me see some important things about myself. I always thought I was a “slob” but I also knew that wasn’t the right word. I’ve never been dirty but messy…. I’ve struggled with clutter my whole life. Child of a hoarder who never really had anyone to teach me…. I tried to do better with my own kids and cleaning and messes and clutter- thanks Marla the Flylady. But I still have a way to go
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thanks for sharing!😊
@mjs.2000
@mjs.2000 4 ай бұрын
Wowza.😮 That was a tremendous amount of work. What a fantastic job. You're all such a huge gift! Bless you for your service
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thank you so much!
@Hundhus
@Hundhus 4 ай бұрын
It’s so satisfying to see the transformations - what a blessing you are to the homeowners you help! I love your kind, nonjudgmental attitude as well!💕
@CampsitePyro
@CampsitePyro 4 ай бұрын
The one thing i learned from watching many cleaning channels and also from dealing with my hoarder Dad is that do not get involved with collecting ANYTHING.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
😁
@cathyprosser1050
@cathyprosser1050 4 ай бұрын
Good job, all of you 👏 👍 💪 I've got to hand it to you, Bonnie for being able to work while there is so much chatter. I like to work alone when I can just get in the "zone", so to speak and allow my mind to focus on the tasks at hand without interruption or an audience. But as big as that job was, it almost required a team effort. Hoping this is going to help "Julie" in more ways than just making a mess go away. That it will be a motivation and a fresh, new beginning for how things will be handled in future. ❤
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Yes, absolutely. I do my best cleaning when I'm just alone and in my zone, but in a situation like this, you have to take all the help you can, which unfortunately, can be super overwhelming to my brain and sometimes it's hard to even think straight to know what to do next. But, I'm sure it's even harder for Julie to let people come in and touch all of her things, so I can't complain about not being able to work alone. I think I will suggest next time I'm there that I just take a room, put in some earbuds, and just work on that space so that I can really focus well.😊
@denagreenway8383
@denagreenway8383 Ай бұрын
You bless so many and such a inspiring person. I am so glad you delete negative messages, only positive comments are needed. I truly appreciate your kindness in dealing with your clients.
@annette2141
@annette2141 4 ай бұрын
What a great job! You are an angel. I couldnt do what you do. Not that i wouldn't help. I just have a weak stomach. You are a blessing for these people, and I'm sure the gratitude that they have is immense. God bless you for all you do. Btw your Mom at 72 is a little spitfire 😊❤️
@kelleybishop6275
@kelleybishop6275 4 ай бұрын
Bless you for all your hard work, compassion and understanding! ❤
@Greatbiggrandma
@Greatbiggrandma 4 ай бұрын
Hey sweet lady! It’s the 71 yr old great granny again. I’ve never seen you do it but I learned to never use window products on glass fireplace fronts ( probably the same for oven doors). They will cause the glass to form an iridescent like film. Kinda like gas on water. No way to reverse it!! Thankful for that advice many years ago!! Also I subbed for the maintenance man at the post office who was taking a vacation. His biggest point he stressed was never to use Comet or Ajax as they are too abrasive and scratch surfaces! Love watching you clean. My back keeps me from activities I see you do!! Love to you and your mom and other helpers!!
@johnkelly9451
@johnkelly9451 4 ай бұрын
Ty for the tip... I have iridescent on my fireplace glass doors forever now! I've finished glass off for years this way. At least I know why now! I will be sure to pass this along to others! Thankyou!
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
I didn't know that. I'm sure many people have ruined their fireplace fronts by doing that because it is, after all, glass. Who would have thought you can't use glass cleaner on it? I'm trying to remember if I have ever done that. I don't think so as I usually just wipe it real quick with my dusting rag after I have dusted everything else. Thanks for the tip!
@danellaweatherly8145
@danellaweatherly8145 4 ай бұрын
Watching your video was informing and uplifting. I was glad to see your message about about respecting the hoarder no matter what. Often people tend to belittle those who have this issue. Please do have more voice overs explaining what your methods are : example gathering plastic bags in one place in order to recycle later or gathering all tagged clothing to go through later, all other clothing to be washed , boxes ??? I hope you “get my drift”! Looking forward to more shows.
@poephila
@poephila 4 ай бұрын
Bonnie I am thinking that the length of the video + the pixelation effects might have been the reason why your software caused you trouble. I work in video production and I would be happy to help troubleshoot or give you some tips if you like. Cheers from Canada 😊
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Yes, I'm sure that had a lot to do with my frustrations on editing this one particularly. I wish it was just limited to that one. Unfortunately, even on smaller projects, it has been super slow since they updated their software and added in AI tools... which I don't even use. And they won't downgrade me to the old version like I asked them to because I'm on a subscription plan.😞 What software do you use for editing? There are a lot of them out there, but only a few that I can actually use on my PC since most of the simpler ones are meant for editing right on your phone and that just doesn't work with what I'm doing.
@lovecleaningslay
@lovecleaningslay 4 ай бұрын
My Dad is 80 and is in better shape then me. He stays active and walks in the woods everyday. Always on the go he don't wanna stop he is always outside keeps him young.
@timetochange3002
@timetochange3002 4 ай бұрын
When my dad was 80 he was on my roof cleaning my gutters. Amazing what they do right? 😊
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
That's amazing! I do think being outdoors is just good for your soul as well. ❤️
@tammyz.677
@tammyz.677 4 ай бұрын
Awesome cleaning video. Terrific help by all cleaners for this family! 💜
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thanks so much! 😊
@SousChef77
@SousChef77 4 ай бұрын
Thanks for the video Bonnie. I am so sorry you had to spend so much time on the editing, etc. We do appreciate all of your hard work. Blessings dear one.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thanks so much! It has been a rough couple of weeks, but it's finally out.. haha! Thanks for the support!
@RoseofSharon3
@RoseofSharon3 4 ай бұрын
Bonnie, I’m telling you. You are a blessing to so many and your mom and helpers too. And did her dishwasher not work?
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thank you! And, no, her dishwasher didn't work. I forgot to mention that in the video. They really just use it as a drying rack.
@ginas.1110
@ginas.1110 4 ай бұрын
Loved seeing your mom working alongside you. She's awesome!! And so great of Lisa to help out.
@dawnsanfilippo6357
@dawnsanfilippo6357 27 күн бұрын
If your thyroid is not functioning (or low functioning) that alone will be exhausting. People are pretty strong. I did bankruptcies for years. This is an analogy, but people can weather a financial storm fairly well, even two. A strong couple maybe three. But no one alone can handle two big storms, and definitely not three. Its wonderful that the world has people like you and your Mom. I wish your friend smooth sailing! ❤
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 27 күн бұрын
Great analogy!
@ingebaeten1598
@ingebaeten1598 4 ай бұрын
Personally, I like the voiceovers most
@mjmooney6530
@mjmooney6530 4 ай бұрын
Great work! It’s easy for everything to get out of hand when there is a bunch of higher priority things going on in life. Accumulation is real and it happens. I empathize because I had a horrible case of Covid (21 days of bilateral pneumonia) where I didn’t regain my stamina until 1.5 years later. Staying alive by breathing was the top priority then the day job. A relative dying and the combination of households is also something I can empathize with; it’s not easy.
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Absolutely. Somebody can be on top of the world one day and then get sick or have some traumatic event happen and it turns their life upside down. That's why I encourage people not to judge these situations because, this lady used to be pretty neat and tidy until all of the multiple traumatic events. So, you just never know. I'm sorry to hear about your covid complications. My best friend is still dealing with long covid and it has been a nightmare for her. It's been almost 3 years and she is still nowhere near what she was like before covid. It really did a number on some people.😢
@_BO.
@_BO. 4 ай бұрын
I 💟the sign on the wall 'Be Bold Color Outside The Lines' 💯
@bevharley8074
@bevharley8074 4 ай бұрын
You are truly doing God's work Bonnie, and of course your mom and your helpers too 🤗
@marloespeters8404
@marloespeters8404 4 ай бұрын
A big 🫂 for Julie ,her daughter and for you and your mother ❤
@cat-mum-Jules
@cat-mum-Jules 4 ай бұрын
Bonnie your mum is awesome ❤. It's true that keeping active physically and mentally is the best. They say use it or loose it. I've lost some due to a medical condition but I do as much as I can. I've always been on the go! It was amazing to see the transformation of the living room. And doing this with the home owner rather than over taking is definitely more helpful. It gives them the control and I think that helps them to keep it from getting out of control again. Great job everyone, and Julie you choose a fab name 😉good morning from England 🏴󠁧󠁢󠁥󠁮󠁧󠁿💞
@viviennejordan215
@viviennejordan215 Ай бұрын
You two are So Wonderful to Help this dear lady out. God Bless You. 😊
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp Ай бұрын
Thank you so much!
@WendyKris
@WendyKris 3 күн бұрын
I hope this person gets through it well because I know what mental illness is, my mom had it and I have it. Prayers for recovery ❤
@KatMayeux-fd5it
@KatMayeux-fd5it 4 ай бұрын
Amazing clean for this lady! Your Mom is a treasure ❤️
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
Thank you so much!
@marriedagain2008
@marriedagain2008 4 ай бұрын
I did miss you last week. That kitchen transformation was awesome. Did anyone else notice that burn spot in the microwave resembles a dog? Great job girls!
@ABeautifulMessExtremeCle-zl1wp
@ABeautifulMessExtremeCle-zl1wp 4 ай бұрын
I hadn't noticed the burn spot looking like a dog, probably because I was so focused on the burned center looking like an "outty" belly button.😁
FREE clean of HOARDED HOME to PREVENT EVICTION- PIANO ROOM & BATHROOM #cleaningmotivation #declutter
42:15
Organizing a mountain of scrapbooking supplies! Where to even start? #craftroom #cleaningmotivation
40:39
The child was abused by the clown#Short #Officer Rabbit #angel
00:55
兔子警官
Рет қаралды 25 МЛН
Final muy increíble 😱
00:46
Juan De Dios Pantoja 2
Рет қаралды 54 МЛН
Вечный ДВИГАТЕЛЬ!⚙️ #shorts
00:27
Гараж 54
Рет қаралды 14 МЛН
Cleaning the Hoard of a Severe Compulsive Spender
31:43
Midwest Magic Cleaning
Рет қаралды 410 М.
Helping a fellow YouTuber (Mira - Peeling Away the Clutter) with her bathroom #satisfying #bathroom
38:27
From Chaos to Clean: Free Cleaning for a Homeowner with Health Issues #extremecleaning #cleanwithme
15:52
FREE help for a HOARDER to PREVENT EVICTION #trauma #compassion #declutter #cleaningmotivation
50:05
A Beautiful Mess | Extreme Cleaning
Рет қаралды 44 М.
Cleaning out a NIGHTMARE garage (We filled 2 dumpsters)
32:02
Midwest Magic Cleaning
Рет қаралды 428 М.
Tackling BASEMENT of HOARDED HOME to PREVENT EVICTION #hoarder #cleaningmotivation #declutter #free
43:08
Cleaning extremely dirty kitchen for single mom with ADHD with 3 kids for FREE #satisfying #kitchen
35:15
Азы программирования в 1С за 3 часа
3:46:49
IRONSKILLS - Курсы по 1С
Рет қаралды 3,5 МЛН
Cleaning extremely cluttered bathroom for single mom w/ ADHD w/ 3 kids for FREE #satisfying
33:07
A Beautiful Mess | Extreme Cleaning
Рет қаралды 95 М.
Не плавайте тут! 🏊🚫
0:24
Взрывная История
Рет қаралды 2,4 МЛН
ПОХОДУ ОН БУДЕТ СИДЕТЬ ДОМА ДО СТАРОСТИ
0:18
Типичный банан 🍌 #shorts #глазунов #юмор
0:18
Robber Got Robbed By Former Marine Officer #trending #heros #superman
0:13
Не плавайте тут! 🏊🚫
0:24
Взрывная История
Рет қаралды 2,4 МЛН
Отомстила слепой сестре 👍
0:55
NKino
Рет қаралды 2,1 МЛН
And how are they not embarrassed?
0:19
Rinuella
Рет қаралды 27 МЛН