Metallica Whiplash Orchestral Cover

  Рет қаралды 16,696

Epic Symphonic Rock

Epic Symphonic Rock

4 жыл бұрын

This is an excerpt from our latest "Metallica's Symphonic Medley 2", just in case you couldn't watch it here is the link for the full-length video: bit.ly/MetallicaSymphonicMedle...
Orchestral score arranged by Micky Tejada.
epicsymphonicrock
epicsymphonicrock
"Metallica Whiplash Orchestral Cover" by Epic Symphonic Rock.
Enjoy yourself as much as we did playing this wonderful arrangement from one of the most influential "metal band" ever, Metallica.
Guitar by Micky Tejada.
Bass by Fabrizzio Huertas.
Drums by Hans Menacho.
Conducted by Javier Fernandez Prada with the "Orquesta Sinfónica de Chancay" y the polyphonic choir "Coro UNI".
Lima Perú.
Stay safe, stay home by now.
Micky😎
#metallica #whiplash #orchestral cover

Пікірлер: 84
@BigQueen23
@BigQueen23 4 жыл бұрын
First
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
I will pin your comment! 😎
@user-me8hy8ew4o
@user-me8hy8ew4o 4 жыл бұрын
@@EpicSymphonicRock So that was a lie😂
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
🤔let me fix it right away
@woodsofypres
@woodsofypres 4 жыл бұрын
You guys did one hell of a job, I was always wondering how would it sound if an orchestra did something off Kill Em All!
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Thanks, "Hit The Lights" is coming this Wednesday. Stay on!
@MisfitKotLD
@MisfitKotLD 4 жыл бұрын
Within Temptation, Therion, and Epica have all recorded live with symphonies and the resulting albums and videos are incredible. Also, check out Metallica's S&M set. Classical and metal get better when combined.
@MisfitKotLD
@MisfitKotLD 4 жыл бұрын
I need a better button than the thumb's up because damn is this good.
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Thanks for watching 😎
@MisfitKotLD
@MisfitKotLD 4 жыл бұрын
@@EpicSymphonicRock Thanks for making this! I love it!
@BiaCorrula
@BiaCorrula 4 жыл бұрын
Brutall !! Magificient Guys !! BRAVO!!
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Thanks!
@miguelangelreyescastaneda2690
@miguelangelreyescastaneda2690 11 ай бұрын
Amazing!💪🏽
@Impalaman1968
@Impalaman1968 4 жыл бұрын
Very impressive guys and gals! Not exactly an easy one to arrange for a classical orchestra to pull off, but you all did a masterful job on this. ..... BRAVO!
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Thanks for watching and for your comment. Stay on!
@salatielricher4149
@salatielricher4149 4 жыл бұрын
Que isso manda muito parabéns aos envolvidos
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Muito obrigado, stay on!
@justgonnagetbetter1037
@justgonnagetbetter1037 4 жыл бұрын
Thanks! Awesome!
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Thanks, stay on, we will upload Mondays, Wednesdays, and Fridays.
@jantzenallen3077
@jantzenallen3077 4 жыл бұрын
Amazing job guys this is fantastic
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Thanks! greetings from Perú.
@jacquesrochetau249
@jacquesrochetau249 Жыл бұрын
Brutal
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Watch the full length video here: bit.ly/MetallicaSymphonicMedleyPart2
@vernondsa9027
@vernondsa9027 4 жыл бұрын
Oh yeah! \m/
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Thanks for watching Vernon.
@tasosvenetsanos
@tasosvenetsanos 4 жыл бұрын
Well done you guys!
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Thanks, stay safe!
@javierguzmanGT
@javierguzmanGT 4 жыл бұрын
Gracias por el pequeño avance. Fue algo genial. Les agradezco los comentarios del Chat. La otra semana los volveré a ver en ese caso. Les mando un saludo desde Guatemala y ojalá puedan hacer El Estanque de Héroes del Silencio
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Anotado heroes del silencio. Esta semana y la siguiente vamos a publicar cada dos dìas, nos vemos en los chats!!!
@hervedziura73
@hervedziura73 4 жыл бұрын
Jolie, du bonheur !!!
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Merci beaucop mon ami.
@jameschavez6400
@jameschavez6400 2 жыл бұрын
Beethoven has officially rolled over🤟❤️🙀
@EpicSymphonicRock
@EpicSymphonicRock 2 жыл бұрын
✌️Greetings from Perú. Micky 😎
@akay1893
@akay1893 4 жыл бұрын
Awesome!
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Where are you from?
@akay1893
@akay1893 4 жыл бұрын
@@EpicSymphonicRock Germany
@user-me8hy8ew4o
@user-me8hy8ew4o 4 жыл бұрын
Very nice🤘
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Thanks for watching. In a few minutes a new video on its way. Micky😎
@darateymourifar4930
@darateymourifar4930 2 жыл бұрын
Aren't they difficult songs to play with an orchestra?! Nicely arranged anyway. Keep it up! Greetings from other side of the world :D
@EpicSymphonicRock
@EpicSymphonicRock 2 жыл бұрын
Greetings, thanks for carefully listen.
@cepreilavr514
@cepreilavr514 4 жыл бұрын
Отлично 👌!
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Thanks!
@marcosandrades2344
@marcosandrades2344 4 жыл бұрын
Adrenaline starts to flow thrashing all around Acting like a maniac (Whiplash)......ficou muito boa 🤜🤛😲😲😲😲
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Whiplash!!! tacatacatacatacatacataca taan taan taaa!
@nelsonm.deoliviera8155
@nelsonm.deoliviera8155 4 жыл бұрын
🇧🇷👍
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Hello, thanks for watching.
@patrycjamika6255
@patrycjamika6255 4 жыл бұрын
Historie it's happy now 😊
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Are you happy now? Thanks for watching 😎
@patrycjamika6255
@patrycjamika6255 4 жыл бұрын
Yes of course 👍 five !
@solpaz9519
@solpaz9519 4 жыл бұрын
No 3
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Genial!
@haniffadhillah6030
@haniffadhillah6030 4 жыл бұрын
i wish i could join
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
You can actually. We are developing the "Epic Global Orchestra", stay on for news!.
@joseph.z.gzz.
@joseph.z.gzz. 4 жыл бұрын
4...
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Genial Joseph, eres un amigo frecuente.
@THESONICSPEEDDEMON
@THESONICSPEEDDEMON 2 жыл бұрын
Where was this?
@manticorepl859
@manticorepl859 3 жыл бұрын
Much better than SM with Metallica !!!
@blisley4857
@blisley4857 4 жыл бұрын
No 2
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Next Wednesday you could be the first! Thanks for your support. ❤
@joseph.z.gzz.
@joseph.z.gzz. 4 жыл бұрын
@@EpicSymphonicRock Va a haber vídeos cada miércoles?
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
@@joseph.z.gzz. estas tres semanas lunes, miércoles y viernes. Estas dos semanas son de Metallica, luego Star Wars, Mario Bros y el primer video de una hora de duración de un show completo.
@joseph.z.gzz.
@joseph.z.gzz. 4 жыл бұрын
@@EpicSymphonicRock 👍🤘👌
@crissc4015
@crissc4015 4 жыл бұрын
Una de Bring Me The Horizon - Drown
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Genial, acepto, dame unas semanas. :)
@MadFat20022002
@MadFat20022002 4 жыл бұрын
КРУТЬ !!! Привет из России, Друзья!
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Greetings from Perù!
@gabrielim8731
@gabrielim8731 3 жыл бұрын
Man..the neck hurts but worth!
@EpicSymphonicRock
@EpicSymphonicRock 3 жыл бұрын
You are one of my team.
@gabrielim8731
@gabrielim8731 3 жыл бұрын
@@EpicSymphonicRock Ty! Can you try some Angra? Namely Temple of Shadows.
@EpicSymphonicRock
@EpicSymphonicRock 3 жыл бұрын
@@gabrielim8731 That's a wonderful idea, let me think about it, to study the music.
@gabrielim8731
@gabrielim8731 3 жыл бұрын
@@EpicSymphonicRock Sick Ty man
@Student777s
@Student777s 4 жыл бұрын
Well, but Maiden with this orchestra is cooler, an order of magnitude.
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Thanks for watching, I invite You to visit our newest video from Iron Maiden.
@___Alex_Sed___
@___Alex_Sed___ 4 жыл бұрын
+++
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
😎♥️🎸
@artemdavinci
@artemdavinci 4 жыл бұрын
Диригент на нашого Ляшка схожий))))
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Greetings from Perú, where are You from?
@artemdavinci
@artemdavinci 4 жыл бұрын
@@EpicSymphonicRock Ukraine
@kusholds4686
@kusholds4686 4 жыл бұрын
It's okay but it was too short.
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Hello, it is part of a bigger medley, you can watch the entire medley here: bit.ly/MetallicaSymphonicMedleyPart2
@belmonth6407
@belmonth6407 4 жыл бұрын
excelente ejecución, ahora lo bueno lo malo y lo feo.. lo malo de esto que al menos a mi me deja un tanto decepcionado que metallica no se atreviera a hacer este tipo de rolas en sus dos S&M despreciando cosas tan chingonas como seek, o phantom lord o four horsemen del kill creeping ,ride o fade del ride the ... o sanitarium dispossable y orion del master, to live, harvester, and justice o blackened del justice, misery del black o atlas del hardwired y haciendo otras porquerías intrascendentes queriendo hacerlas pasar como grandes composiciones y maravillosas adaptaciones, lo bueno de todo esto es que verdaderos artistas como ustedes procuran que la buena música prevalezca en tiempos donde la mayoría escucha ritmos que ni la pena valen mencionar, lo feo que metallica es la única banda que a estas alturas de la vida suena horrible (lars mal ejecutante por mas que quieran defenderlo, a kirk ya le da hueva hacer un solo decente, el bajista que traen de invitado en todas las giras parece todo menos integrante de una banda de heavy y por mas buen bajista que sea no se ve ni se siente como integrante de metallica) y quienes los coverean suenan mucho mejor que los originales ,el pilón....por mucho sus ejecuciones suenan impresionantes exactas, se nota que lo que hacen lo hacen por amor a la música, se nota en sus rostros en su técnica en cómo están disfrutando tocar. desde ciudad de méxico mi respeto y admiración por la gran labor cultural que hacen pero sobre todo mi agradecimiento por su esfuerzo en difundir la conjunción de dos mundos tan cercanos en su sentir y tan lejanos en el tiempo...larga vida al rock
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
Hermano què bello tu comentario, eres de los mìos!!! el mièrcoles se estrenarà otra èpica del Kill Em All. Conversa siempre con nosotros. Micky (el guitarrista y compositor de las versiones sinfònicas)
@belmonth6407
@belmonth6407 4 жыл бұрын
@@EpicSymphonicRock super!!! otra del kill anticipo una version increible!!! las versiones que han hecho de maiden son sobrenaturales...por decir lo menos sabes que estaria bien para estos tiempos de incertidumbre y encierro? creo que podrian hacer un podcast con un poco de los ensayos o la seleccion de canciones el ensayo con la orquesta, no se cosas que normalmente no vemos pero que son fundamentales para el exito que tienen y que estoy seguro a todos los que somos fans del EPIC SYMPHONIC ROCK nos va a enajenar. saludos desde la solitaria ciudad de méxico
@EpicSymphonicRock
@EpicSymphonicRock 4 жыл бұрын
@@belmonth6407 Muchas gracias hermano, saludos desde Perù! espero ir pronto para Mèxico una vez que la locura haya terminado.
Metallica Whiplash (Dave Mustanie and Cliff Burton)
9:30
David Luna Reyes
Рет қаралды 475 М.
WHAT’S THAT?
00:27
Natan por Aí
Рет қаралды 13 МЛН
Зачем он туда залез?
00:25
Vlad Samokatchik
Рет қаралды 3,2 МЛН
Metallica - Nothing Else Matters | Epic Orchestra
6:21
Epic Orchestra
Рет қаралды 10 М.
Iron Maiden Symphonic Medley II - The Trooper, Hallowed be Thy Name and Aces High.
6:35
The story of Money for Nothing is weirder than you thought
8:53
David Hartley
Рет қаралды 612 М.
WHIPLASH - METALLICA - Drumming Tag Team
4:25
Josh Steffen
Рет қаралды 183 М.
Mind Blowing❗️SOUND-ALIKE Voices of FAMOUS Singers! 😱
29:01
Top Talent
Рет қаралды 3,6 МЛН
Metallica - Whiplash (Guitar Lesson And Cover With Tabs)
4:25
Duel Of The Fates - Star Wars Episode I - Epic Symphonic Rock
5:58
Epic Symphonic Rock
Рет қаралды 35 М.
After Hours Big Band - Whiplash (live)
4:45
HightopMaestro
Рет қаралды 128 М.
SmokeOnTheWater, Burn, HighWayStar Orchestral Medley.
6:32
Epic Symphonic Rock
Рет қаралды 33 М.
Stray Kids "Chk Chk Boom" M/V
3:26
JYP Entertainment
Рет қаралды 53 МЛН
akimmmich (feat. Turar) - UMYTTYŃ BA?| official lyric video
2:54
akimmmich
Рет қаралды 3,7 МЛН
Zattybek & ESKARA ЖАҢА ХИТ 2024
2:03
Ескара Бейбітов
Рет қаралды 539 М.
Jakone, Kiliana - Асфальт (Mood Video)
2:51
GOLDEN SOUND
Рет қаралды 10 МЛН
LISA - ROCKSTAR (Official Music Video)
2:48
LLOUD Official
Рет қаралды 127 МЛН
Nurmuhammed Jaqyp  - Nasini el donya (cover)
2:57
Nurmuhammed Jaqyp
Рет қаралды 340 М.