utreon.com/c/forgottenweapons/ / forgottenweapons Cool Forgotten Weapons merch! shop.forgottenweapons.com patents.google.com/patent/US1... Contact: Forgotten Weapons 6281 N. Oracle 36270 Tucson, AZ 85740
Пікірлер: 4 900
@richieb76922 жыл бұрын
Considering all the springs, sliders etc, are all over 100 years old. I'd say its working really well Fantastic design
@keyboardstalker47842 жыл бұрын
They sure don’t make them like they used to.
@intrepidferret67042 жыл бұрын
@@keyboardstalker4784 yeah, "the best designed product, meets you need and doesn't last."
@kenanderson39542 жыл бұрын
Yeah, it feels like a bit of calibration and fresh springs would make this thing run real smooth, it's impressive they've held up as well as they have though.
@BreakdancePeach2 жыл бұрын
@@keyboardstalker4784 In 100 years, a future soldier shoots a functional M4 Carbine or M16: "Wow, weapons from 2022 still work! They sure don't make them like they used to!!!" That's because all the bad products from 2022 already disintegrated. It's 'survivorship bias'. It's why you don't see the bad stuff from 100 years ago, because they all already broke down and were scrapped. I can't buy that things were magically better back then. Anyway, not directed at you in particular, but it's weird, the comments that don't think garbage American products and cheap con-artists were JUST as common back then. The issue was seriously so bad, that they invented an insult so popular it still exists today -- "Snake oil salesmen". Aside. I'm so happy Ian finally did a video on the Alofs. I've been wanting to see this for a long time.
@immortal218 Жыл бұрын
Springs at 2.54 are not that old
@infamoushacker4chan8832 жыл бұрын
Honestly, I *love* this. It screams steampunk, but unlike random exposed gears on a hat, it has practical use. I wish I were a machinist so I could recreate this with modern carbon steels and for today's standard shell length.
@RandarTheBarbarian2 жыл бұрын
I wish you were too, because I'd like to purchase a left and right pair and cobble them onto a dual triggered side by side for the most absurdist BS I can come up with...
@canobenitez2 жыл бұрын
"but unlike random exposed gears on a hat" shots fired
@t4nkychannel9212 жыл бұрын
@@canobenitez Most likely from an Alofs, no doubt.
@airplanemaniacgaming78772 жыл бұрын
@@t4nkychannel921 you can hear the singe-shot-turned-lever-action shotguns!
@cookieschocchips55512 жыл бұрын
You'd also need to be a gunsmith... As a machinist though, those parts wouldn't be impossible to manufacture. (Unfortunately the law and my lack of a modern lathe prevents me from manufacturing them)
@Lethyss Жыл бұрын
When I saw the shotgun in Hunt: Showdown with this system, I thought it was something weird created for the game. But damn, it's a real life design.
@DetectiveLance Жыл бұрын
Isn't it great!? I started playing Hunt again for the first time in a while and I was like "wait, haven't I seen this before..."
@thertsfan Жыл бұрын
I remember seeing this device attached on a double barrel shotgun instead for demonstration purposes, but I don't remember the video
@DetectiveLance Жыл бұрын
@@thertsfan Shit, now I gotta find that atrocious looking thing.
@thertsfan Жыл бұрын
@@DetectiveLance I'm not sure if I'm missremembering, could be that I mistook that device for a second barrel of a double barrel shotgun, been a long while
@gozadinhaplays69 Жыл бұрын
EVERY gun on hunt showdown exist in real life, they got these forgotten guns and changed their names for the game
@ABCDEFGHIJKELA... Жыл бұрын
A pocket full of shells, and a proper break action(with eject) is pretty damn fast once you get used to it, so I can understand why this didn't catch on. It's still beautifully designed, considering how raw everything is, and being a lover a mechanical movement, it would definitely be a wonderful item to have!
@creakycracker Жыл бұрын
I remember watching my Dad take out 4 phesants in about 5 seconds by keeping 3 shells in the web of his left hand. I practiced this technique as a boy but never got as good as he was.
@TheMulti3138 ай бұрын
I would imagine adding a lock of some sort to keep the feeder away from the chamber, so you could still operate it as a regular break action would've helped. Its like the SMLE'S with the magazine cutoff so you could feed fire it, but still have a mag ready if you needed it. Would've worked wonders for bird shooting.
@samuelstacey23096 ай бұрын
I think you are spot on, I completely agree! Though I too am a lover of fine mechanical movements lol. So we’ll put, like clockwork!
@Girvo7472 жыл бұрын
The fact this thing works with 100 year old springs in such a Rube Goldberg manner and actually DOES work is amazing
@lukewarmwater64122 жыл бұрын
not realy. people took pride in their products back then, not at all like now.
@Zaque-TV2 жыл бұрын
@@lukewarmwater6412 things made in the USA and not outsourced for cheap labor are very well made. Even down to some zipper pouches I bought. Support US made!
@nick45062 жыл бұрын
@@lukewarmwater6412 spring steels now are way better. and back in the day there was no way to make something cheap because plastic didn't exist and international shipping was incredibly expensive. people didt take pride in there products, they cheaped out exactly as mutch as physically possible at the time. and stuff back then was stupid expensive like 32 bucks in 1927 is 521 today. you could buy a whole repeating shotgun for that money not just a conversion kit for that.
@chuckhoyle12112 жыл бұрын
The best thing about it is that even if it fails in some way, there is no danger to the user. You may eat a spring loaded shell, but I don't see a way to accidentally fire a shell out of battery with this contraption.
@Aliyah_666 Жыл бұрын
@@lukewarmwater6412 Bro metallurgy was trash back then, pride....lol funny you said pride and meant cheapest possible solution.
@Abatement72 жыл бұрын
What is more impressive is the spring tension is still good after 100 years
@tochka8322 жыл бұрын
probably is replaced tbh, but who knows
@Oblithian2 жыл бұрын
I suspect that may have been the source of malfunctions. Or people doing it improperly like that one instance.
@mpetersen62 жыл бұрын
As long as the springs haven't been compressed and released 100Ks of thousands of times and gotten rusty there's no reason they should have failed.
@fairulaiman96482 жыл бұрын
If it on my table, i rather swap the spring with semi auto revolver prototype in the early videos and add up grips to improve the chamber capacity and stable rate of fire.
@XWar_LockX Жыл бұрын
Theses are the kinds of "weapon modifications" I love to see. Really would like to see things like this in more FPS games
@nightraven836 Жыл бұрын
would be awesome to see in a Fallout game.
@nazaryunis2443 Жыл бұрын
its in hunt showdown as the romero 77 alamo
@XWar_LockX Жыл бұрын
@@nazaryunis2443 Awesome!
@theshellderinslowbrostail542210 ай бұрын
There is a weapon like this in Warframe called the Rauta
@1SilverDollar8 ай бұрын
@@nightraven836would have been a beautiful mod for the single shotty
@Farfetchd. Жыл бұрын
This video single handedly brought this attachment to Hunt.
@jasonk15402 жыл бұрын
The only thing that disappoints me about this video on such a cool mechanism working, is the fact that we didn't get to see any high speed footage of it. Getting to see it work in slow motion I think would be REALLY cool!
@matthaught47072 жыл бұрын
Check out C&Rsenal's videos on it, they have some slow-mo of it operating with snap caps.
They had so much funn with this system that they probebly forgot about it XD
@xmanhoe2 жыл бұрын
You can slow down the video speed 😉😎
@MrPanzerDragoon2 жыл бұрын
As much as I love seeing the modern and advances milled weapons out there, THIS TAKES THE CAKE for just the sheer cleverness of the homegrown style, steampunk like, design.
@MrPanzerDragoon2 жыл бұрын
@@industrialvectors yeah, it's steam punk like for sure. But it's just one of those unique work arounds. Not all work arounds are pretty, I will have to admit, but when they work...it just shows there were some hard and clever thinking involved. I love it!
@zealot7772 жыл бұрын
I would say more diesel punk. But it works for both.
@calm_skies11272 жыл бұрын
basically, it made the entire grip and stock part into the lever of a lever action? THAT'S GENIUS!
@graham1034 Жыл бұрын
Given that it still functions reasonable well after 100 years, I bet it worked almost flawlessly when new.
@grimmjowjaegerjaquez37503 ай бұрын
And modern springs are way better. The design is solid and can use longer tubes for more ammo if you can handle the weight
@bfchristianbf2 жыл бұрын
i imagine what a device like that would look like for a double barrel,like two of these one on each side,or maybe just one for the 5 plus 1 ammo capacity
@mattandrews85282 жыл бұрын
Kind of like the Bioshock 2 double barrel capacity upgrade? I loved the look of it in the game.
@RalphReagan2 жыл бұрын
Yes! :)
@Excalibur012 жыл бұрын
It'd be like if Kel-tec existed in the 1800s
@calvingreene902 жыл бұрын
A longer magazine tube with two transport tubes and one spring pushing both shells out at the same time so that they load the correct barrels.
@User-dc6sm2 жыл бұрын
you'd have a steampunk DB-12 or DBS
@RTJsims2 жыл бұрын
I am honestly shocked you guys didn’t slow motion capture the reloading sequence. We need that in our life.
@SundownMarkTwo2 жыл бұрын
C&Rsenal has a video on the Alofs and has slow-mo for it.
@AbananaPEEl2 жыл бұрын
kzfaq.info/get/bejne/nrR5nsaSndGVhYU.html This is the C&R vid with the slowmo
@saintrico34562 жыл бұрын
And as I watch the reload slow motion sequence for the 20 millionth time; I would need to have a backup tab open so when my wife walks in I can pretend I'm just watching porn.
@shooterqqqq2 жыл бұрын
Check the settings in the lower right hand corner and select video speed.
@haylinpm89732 жыл бұрын
@@shooterqqqq I was about to say this
@JimTheZombieHunter2 жыл бұрын
I love how this channel focuses on historic and obscure .. and sometimes unique and bizarre - firearms engineering rather than how many pumpkins can be blown up. You bring a certain awesome class and honest respectability to shooting.
@gsilva22011 ай бұрын
It's like Jay Leno's historic car show
@Ciel1820 Жыл бұрын
I'd love to develop a 3d print for one of these to modernize 'em a bit. It would take a bit of fiddling with the spring strength to get perfected. It's such a cool design yet it's a shame we don't have any modern continuations of this patent.
@gruntysskim4145 Жыл бұрын
absolutely do it my man, that's what 3d printing is for.
@TylerLL21129 ай бұрын
I have seen many comments like this. Yet, nobody has done it. There must be some gotcha that we don't see until we work on it. I too intend on messing with this idea. Though, in .410 as that's the only break action I have.
@paddy20196 ай бұрын
You can get new ones in Canada. As far as I know, they work pretty well.
@ShitfazeMigee-cu1vt5 ай бұрын
Don't fiddle with the design 😂 it's 100 years old and it most likely functioned perfectly out of the box. I'm sure you could improve it but don't fix an issue that doesn't exist
@ALWhite-ub1ye5 ай бұрын
@@paddy2019are they sold under the same name? Did they ever produce one in .410?
@Vaultmon2 жыл бұрын
I don't care that pump and semi shotguns are available, I want one. Also, imagine if a similar contraption was made for the m79 grenade launcher.
@nothim73212 жыл бұрын
Who needs an m203 or m320?
@sarath4312 жыл бұрын
There exists something like that. It is called china lake. Its a pump action style grenade launcher. I too love to see a m79 with alofs system
@46jerdboy2 жыл бұрын
I think grenades would be too heavy / potentially dangerous (front to back misfire chance would be very low, but catastrophic).
@Vaultmon2 жыл бұрын
@@sarath431 I know. But pump action is not the same as alofs.
@sarath4312 жыл бұрын
@@46jerdboy - the weight is indeed an issue. However, the chances of exploding via dropping is less as the grenade require some arming distance like 5 mts. It'll be a rare case the grenade might explode upon dropping. I might be wrong on this.
@adamshira63682 жыл бұрын
Someone needs to remake this with modern materials and manufacturing, for no other reason than just because it would be cool!
@StreakedSilver2 жыл бұрын
Get Brownells on it
@stevenlee7982 жыл бұрын
I'm sure Mr Novak would be delighted to take on this project 😀
@stevenlee7982 жыл бұрын
I'm sure Mr Novak would be delighted to take on this project 😀
@jacobmccandles17672 жыл бұрын
Im also sure you're looking at quite a price in today's world. The Krag-jorgensen for instance would be about $3500 worth of machine work.
@anilin63532 жыл бұрын
The ender 3 goes brr my friend
@Astraeus..2 жыл бұрын
In regard to $ value of 1925 vs today, it's roughly 16x what it was. So the 6$ attachment is an equivalent of around 96$. A break-action shotgun's 15-20$ would be 240-320$, and the 35+$ pump-action would be 560$+. Pricing seems to be roughly in line with what can be found today, although obviously we also have guns that are considerably above those price points. Very interesting all told.
@Sk8RJOSH9410 ай бұрын
I would love to know where to buy one of those devices
@notanuberweeb Жыл бұрын
this is actually one of the coolest designs ive ever seen
@Senator_Byrd2 жыл бұрын
9:22 Imagine the creator and his boys having this same excited “heh heh!” over 100 years ago
@Pcm9792 жыл бұрын
I've always wanted to see two of these mounted to a double-action shotgun as an upgrade in an FPS. In real life it'd be a hilarious disaster, but in the world of say Bioshock it could work perfectly and look cool doing it.
@Attrixine2 жыл бұрын
So effectively something to increase the firerate of the doom super shotgun
@Louber11152 жыл бұрын
The reload would take a good 20 minutes 😂😂😂
@vahidmoosavian63132 жыл бұрын
That'd be awesome!!! Unless BF vanguard team gets wind of it😒.
@notablediscomfort2 жыл бұрын
have the ammo tube work like a magazine so to reload you twist a thing and slide it off then put another one on. but have a different animation for topping off where you just top it off normally.
@abysswalker25942 жыл бұрын
Metro would work in that 2
@brentward3893 Жыл бұрын
This really reminds me of the weapon upgrades in Half Life Alyx - alien tech thrown onto old weapons to improve performance, such as robotic arms to auto reload pistols. It's so cool that something like this really exists, and it's a hundred years old!!! Fantastic design.
@dioarya627511 ай бұрын
Or maybe like how it works during that scene in "Equilibrium" where Preston just reload his two guns with an autoloader device under his sleeve
@evanlee93 Жыл бұрын
This is unbelievably cool. I love old mechanisms like this.
@jeffprice64212 жыл бұрын
When this was new, I don't think people had the expectation of flawless function that we have today. So the little bobble to get the round to feed would have been taken in stride and without much notice... Very cool. Tinkering at it's best.
@sgas2 жыл бұрын
I thought it was old and that's why it's not perfect
@DjDolHaus862 жыл бұрын
Yeah there is also the cost factor of upgrading the single shot break action you've already got versus buying a new pump action to consider. It doesn't have to work perfectly straight out of the box, it just has to work well enough for the price and offer enough fine tuning for someone to make it work better
@beargillium23692 жыл бұрын
So you've never heard the phrase "they don't make em like they used to"
@Gameprojordan2 жыл бұрын
@@DjDolHaus86 iirc this thing came out around the time pump actions were first introduced. So they were expensive enough where this design was an actual cost effective alternative at retrofitting a commonly owned single barrel break action shotgun into a repeater shotgun
@MasterN642 жыл бұрын
I very much doubt this though. There are many examples of firearms this old and older that are semi auto or pump actions that function basically flawlessly and they would have been the standard at the time. This would have absolutely been looked on unfavorably and its easy to tell that it was considering that the concept never caught on and it faded into obscurity.
@katori.mp46472 жыл бұрын
This looks like a badass videogame upgrade, never thought I'd see someone so cool irl
@danbell38272 жыл бұрын
It really does, like something from metro, to turn a single shot into a magazine fed gun, made out of scrap tube and springs.
@lxDastanxl2 жыл бұрын
a lot of players from hunt showdown are asking for it so since the game it's actually going well they may try to put it in this shotgun it's call Romero in the game
@Sn0ws5192 жыл бұрын
@@lxDastanxl I was just going to comment this. I immediately thought of Hunt when I saw this, it would fit in perfectly.
@weaponizedautism32692 жыл бұрын
I wish we had this in hunt showdown
@walkingburgers952 жыл бұрын
@@lxDastanxl I saw this shotgun attachment about a year ago and my very first thought was "we need this in Hunt". It'd be really cool
@vect0rwolf Жыл бұрын
Devs for The Hunt: Showdown are in the back scribbling notes.
@Xanatos7125 ай бұрын
They sure did!
@martgryfny Жыл бұрын
I think that if you adjust that bolt at 2:56 (you have a fingertip underneath it) the loader will work without hesitation. It aligns the loader tilt with the barrel. On the video it looks like the tilting action goes too far. And then you might want to adjust the height on the mounting system. And that repeat these two steps in aligning 425421 times and you good to go :D
@wesleykupic6272 жыл бұрын
Just the sound of that reload; all the springs, levers, movement falling into place perfectly is beautiful
@acomingextinction Жыл бұрын
It's so satisfying. It's the sound of mechanical rhythm.
@catcatcatcatcatcatcatcatcatca2 жыл бұрын
This thing is genius. I imagine it started as “what if a cylinder holding a new shell could push the it into barrel automatically?”. And then each and every problem that arises was addressed one by one. Where does this cylinder come from? It pivots in when the lock is opened. How does the old shell get ejected? The ejected shell triggers the mechanism, so the cylinder only pivots in after successful ejection. How does the cylinder hold the shell in while not in action? There is a blockage on the side of the gun… Wait let’s put more shells held under spring tension there! Those shells get held on the side by an extra blocker when the mechanism operates. I think it looks steam punk because every piece is visible and has a simple function. It’s not that the mechanism is overly complex, but that it has many simple steps that none were hidden or integrated to one part. You can pretty much draw a circle between each and every part of the action, and end up with the whole shape of the visible area.
@peglor2 жыл бұрын
This design could be tweaked do the same for a double barrelled shotgun too, especially an over under layout by putting two on one gun.
@ComotoseOnAnime2 жыл бұрын
@@peglor That would be kinda insane with an over under, effectively an 8+2 break action shotgun, on par with some modern magazine fed shotguns. And there's really no reason the feed tubes couldn't be extended with lighter modern materials to potentially double capacity, or use a more effective spring to allow for shortie shells to be used, potentially adding a couple more shells in as well. Just imagine loading an entire box of ammo into one of these things lmao. OOoo, you could also potentially make detachable tube mags, something similar to an SRM 1212, with a little spring loaded catch to prevent shell expulsion that would be interfaced with a nub on the receiver, which would cycle two shells into the moustrap elevator thing to be cycled into the gun. I can think of a half dozen ways to improve this design to make it higher capacity and more reliable.
@BleedingUranium2 жыл бұрын
@@peglor I would love to see a pair on a side-by-side, it would be so wide hahaha
@njones4202 жыл бұрын
I'd like to see a scaled-up one on an M79.
@clonemarine12 жыл бұрын
@@njones420 How different would that really be from a China Lake? lol
@Darryl1963D5 ай бұрын
My 60th birthday today and what a great content to see. This is really great to see as you say, many devices never really worked. This one is fascinating. Well done!
@Daniel-uh5fm Жыл бұрын
So that's where Hunt devs are getting their ideas
@eliandominguez35752 жыл бұрын
Crytek is literally taking note for putting this in hunt showdown
@RmacNet2 жыл бұрын
Wait - for real? My first thought when I saw this was it needs to be in Hunt
@yurimanniello52862 жыл бұрын
as i said before this thing belong to hunt showdown, romero variant would be fun entering compounds blasting like a k&k but with a damn romero
@casey14412 жыл бұрын
This mechanism seems more complicated to design than the whole gun, and I love it.
@absalomdraconis2 жыл бұрын
It's like half a step past the complexity of those twin hammer revolver.
@frbe01012 жыл бұрын
Its the really weird reloading mechanism that I love about this channal more then anything else.
@jonathanphillips30522 жыл бұрын
I am suprised they didn’t have some varient showing up in either a western game, steampunk game, or a post apocalyptic game. Like it could fit so well as a shotgun mod for a single barrel shotgun, or if you get wilder, a double barrel with 2 on each side.
@frbe01012 жыл бұрын
@@jonathanphillips3052 I can see doomguy with a double barrel version now!
@n3m3sis03 Жыл бұрын
Hunt Showdown gun research brought me here. I find myself suddenly in love with these 18th-19th century weapons.
@gunthersunshine9418 Жыл бұрын
many people from the hunt community requested the alof and crytek really did it :D
@bigtuna4731 Жыл бұрын
This was patented in 1924, so it's a 20th century weapon, not 18th-19th. They keep saying it's 100 years old, so not sure why you would think it's older.
@epejija9519 Жыл бұрын
Hello from Hunt: Showdown community!
@ObsoleteVodka2 жыл бұрын
Would be cool if someone makes an entire gun around this concept. Impractical for sure, but undeniably cool.
@This_is_my_real_name2 жыл бұрын
I'm surprised there was never a field artillery piece that used this concept. Maybe they didn't want to pay his patent license fee?
@noahboat5802 жыл бұрын
@@This_is_my_real_name seems too complicated to make an alofs-styled magazine tube for an artillery piece, especially when manpower is its own action for any artillery piece.
@bstrd55732 жыл бұрын
This is the whole definition of steampunk:"very impractical, but very cool looking"
@Schregger2 жыл бұрын
@@bstrd5573 Was about to say, "impractical, but cool" is the whole point of steampunk. Now, you make something like this for a double barrel side-by-side, that would be a interesting videogame gun.
@maxpulido42682 жыл бұрын
Going bankrupt is never as cool as it seems
@codyopperman59302 жыл бұрын
17:02. You can see the problem that causes the boble to be necessary. The transfer tube is over too far. The adjustment screw is probably worn from use, and needs to be tightened so the tube doesn't go so far. Or replaced, depending on if it will move.
@lunarpking2 жыл бұрын
It's REALLY close to being right too, I could see it being fixed easily.
@ozzymandius6662 жыл бұрын
I bet performance would increase a fair bit if made with stiffer modern steel.
@Noarisonn2 жыл бұрын
Also the angle that Ian is breaking open the shotgun is a bit upward for the camera to see if he pointed it down the way most people operate a break action it *might* be a little more reliable.
@ethinos27192 жыл бұрын
One of the screws on the transfer tube turned easily as he was handling it during the show-n-tell portion of the video. I wonder if it was still loose when he was shooting it.
@daviddomanski48722 жыл бұрын
@@Noarisonn I noticed that too! It was always smoother with a more muzzle down barrel position.
@theaddictive6676 Жыл бұрын
god just the idea of someone seeing a break action shotgun and saying "fuck it I'm turning this thing into a makeshift pump action" and succeeding baffles me to no end
@ImusNoxa Жыл бұрын
Watching your channel has given me a new appreciation for gun mechanics in general, but something about this... contraption is just so freaking cool. It's amazing.
@akaLethal2 жыл бұрын
The Alofs seems to load more reliabily when the shotgun barrel is pointed towards the ground. Most of the hiccups occured when the shotgun barrel was at or near horizontal. It appears that when the barrel is pointed down, the shell is able to slide a bit further into the chamber which helps it to clear the receiver when closing the action. I bet a thorough cleaning and perhaps light oil on the chamber would aid reliability as well. Very cool video, nonetheless. Thanks!
@silentferret10492 жыл бұрын
I would give in part that the spring more than likely being original could be weaker than new so that could cause the bind ups.
@timfoster79792 жыл бұрын
I have one mounted to my Grandfather’s Champion 12ga. The barrel has had so many buckshot shells run through it the top end has grooves.
@nickmaclachlan51782 жыл бұрын
Not wanting to be a Safety Sally, but with that much wear on it, I'd probably retire it to a mount on the wall......... you don't want it blowing up in your face.
@dai2dai2462 жыл бұрын
@@nickmaclachlan5178 why ? If the chamber is fine, you won't have issues. It isn't a rifle, you can drill a shotgun barrel without it exploding...
@youtubeSuckssNow2 жыл бұрын
@@nickmaclachlan5178 as long as the chamber is fine then theres nothing really wrong with it. Theres not really anything that would make a shotgun barrel explode
@dundun86402 жыл бұрын
please post a video i have no idea what you said but it sounds like something i want to see (the grooves (i have no idea what top end means))
@colejosephalexanderkashay6832 жыл бұрын
totally do a video of this
@garciasdv Жыл бұрын
romero alamo it's you?
@mitchmalinowski7103 Жыл бұрын
They just added this to Hunt: Showdown so i had to come back and drop a shoutout to Ian for being the reason more than 3 people in the 21st century have ever heard of this…thing.
@h.a.98802 жыл бұрын
The whole design, the basic idea and the intended market... This is absolutely genius. And to think it runs this well after a hundred years, I would not be surprised if those hiccups were very uncommon when it was brand new. And even if that wasn't the case and it had those hiccups out of the box, it's still nothing more than a tiny inconvenience to an amazing, useful gadget. If you squeezed my arm and forced me to come up with anything that could be improved, I'd suggest to add a lever that disconnects the feeding tube tilting mechanism, so when the main tube runs out of ammo, the feeding tube gets fixed in place so you can manually reload without the feeding tube getting in the way.
@TheHatori12 жыл бұрын
I love how the designer encounters a problem, finds a solution and not only makes it work, but also makes it kinda universal. Which is why I think that it wasn't flawless even back in the day - it seems that the main problem is the fit, not springs or something. Either way, systems like this are what makes me interested in weapons from engineering perspective, even though I have never had an oportunity to shoot one.
@1978garfield2 жыл бұрын
I suspect the springs are worn out. Not so much from use but from age.
@khrisnaadi86532 жыл бұрын
I think I have the faint image of the feeding mechanism to the magazine(?) but not the problem of the feeding tube get on the way. For my image, just make some sort of one way resistor(?), make it active when the feeding tube in reload state and disabled when in feeding state. For your problem, adding some mechanism that doesn't conflict with the feeding tube's spring is kinda hard. Maybe like add some mechanism to the spring under the the feeding tube where when the feeding tube is empty, the feeding tube slide to the side more when the gun's barrel closed by tweak the already existed spring's mechanism or add some new. That might also can solve the problem of barrel alignment issue if the spring can be adjust.
@h.a.98802 жыл бұрын
@@khrisnaadi8653 I was imagining a little plunger that gets pushed out when the feeder tube is empty and then arrests the inward tilting. As long as there's a cartridge in the feeder tube, the feeder tube is movable, when the feeder tube is empty (ie: no more ammo in the magazine) the feeder tube gets fixed and you can just use the gun like a normal break-action.
@jth_printed_designs2 жыл бұрын
@Jorj Yeah, it looked like a tuning issue. If the transfer chamber was limited in how far down it swung then it wouldn't bind the shell half way into the chamber. It would be in good alignment and the hiccup would disappear.
@jubuttib2 жыл бұрын
The fact that it's such a weird design, managed to be a cheaper combination than an actual repeating gun, worked back then, and STILL mostly works today with nearly 100 year old springs... I'm honestly flabbergasted. I don't even have a shotgun, yet I want one of these. Someone will surely come up with a 3D printable design (with store bought springs and metal pipes) for this at some point. EDIT: And it wouldn't even be that much more difficult to design some quality of life improvements into this, like a cut-off for the loading mechanism when empty, so that it doesn't get in the way of loading manually after you run out, cartridge stops, etc...
@pouncepounce74172 жыл бұрын
no need to 3d print, all parts are either tubing, plates or springs or bars, minimal workshop equipment should be enough
@sirapple24062 жыл бұрын
Loading cut off could be done by having the follower stick out slightly into the “loader” thereby basically jamming the system, all you’d need then would be a slot and hole in the follower and magazine tube to pull back the follower. Or just have a slot going all the way down the magazine tube attached to the follower allowing you full control over it.
@TylerMcL3more2 жыл бұрын
Lol- that’s the first thing I thought too! My friend is actually about to start modeling this as they’ve been wondering exactly how it works for years… and Ian’s explanation explained the last bits so… design time!
@TylerMcL3more2 жыл бұрын
@@W1ldt1m the reason is that it’s cool- why must you hate that what which is nifty?
@alexisrivera200xable2 жыл бұрын
Flaring up the tubes a millimeter at the ends would clear the feeding issues and would speed up the loading process while at it. its a clear simple design so its not difficult to improve on it to up the reliability.
@reecethurman4714 Жыл бұрын
This is such a fun design, and the movement of the action is incredible!
@kubekzpiciem Жыл бұрын
I found this after I saw that they added this version for Romero in Hunt: Showdown, so cool to see it was actually a thing.
@TimperialBroadcastingAgency2 жыл бұрын
This is where you can really see that Ian is, deep down, a mechanist that loves mechanisms. He just really wants this to work and is so happy when it does.
@evilparadigm Жыл бұрын
That's me too. I love the French(I think it was French) MG that has the little rod supporting the iron sight that corrects the sighting, as the barrel of the MG heats up the sight post. It's one of the guns Ian reviews. I do a lot of #D printing and am excited to get into gun smiting some day!
@Zorglub1966 Жыл бұрын
@@evilparadigm I love this kind of "tricks" too. It's the Saint Étienne (*) Modèle 1907 (*) pronounce "saintaetiaenn" all vowels shorts
@doomer_to_boomer24022 жыл бұрын
The ingenuity of the designers of this era never ceases to amaze me
@ASlickNamedPimpback2 жыл бұрын
Einsteins in the 18th century Well, besides actual Einstein but yknow
@burieddagger80642 жыл бұрын
@@ASlickNamedPimpback Einstein wasn't born in the 18th century, he was born in 1879, which is the 19th Century. This conversion is from the 1920s, so the 20th century. It's actually from 1923, the same year Einstein gave his Nobel Lecture "Fundamental ideas and problems of the theory of relativity"
@H4FF Жыл бұрын
I always find this intriguing. Does their ingenuity surprise us because it was a 100 years ago, and we don't see people as quite as advanced back then? They weren't less intelligent or resourceful, they simply did not advance quite as far technologically. I do get what you're saying, but when I catch myself thinking like that I sometimes wonder if there is some weird kind of "bias" going on. Similar to how it surprises us when ancient civilizations made very complex and sophisticated buildings and artwork, for example.
@yourlocalweebfriend3537 Жыл бұрын
Its merely a matter of ‘We do with what we have’ kind of mindset
@tomwoodrow5494 Жыл бұрын
@@H4FF Man kind has had great knowledge for many centuries, engineering principles have not changed that much either. Devices like these are amazing not because of what they do, but rather how they were made. Modern tech could make this device easily, how it was made 100 years ago, mainly by hand, that is the amazing part. This device is no more complicated that most timing machines out there now, the challenge is timing needs precision. I might try to make one, does not look that hard.
@xSephironx2 жыл бұрын
Guy that shot with the alofs near the end... I would NEVER let him anywhere near my stuff. Especially not my firearms. Cocky, impatient, broke your damn alofs and kept firing. Reminds me of a friend of mine
@johnc91262 жыл бұрын
I've got one in 20 gauge with the Canada patent dates on it. They were sold through The Iver Johnson Sporting Goods Company which was owned by Iver Johnson Arms & Cycle Works. Haven't seen it listed in any of the IJA&CW catalogs.
@samuelneese4822 жыл бұрын
I'm amazed that it actually worked. I'd imagine that when it was brand new it probably functioned quite smoothly if it works this well after all this time. I think part of the problem might be that 2 3/4" shotgun shells are the norm nowadays but they weren't back when this was made. I have dug up a box of shotgun ammo that my grandfather had and it was 2 1'2" which leads me to believe that the shells this was designed for were 1/4" shorter.
@JCGver2 жыл бұрын
I wonder if any of the youtube machinists would be down for reproducing a one of, I mean with the patent in hand it shouldn't be impossible.
@beeboop17262 жыл бұрын
Yeah I have a sbs made in 1921 and it has 2 1/2 inch chambers, 2 and 3/4 inch chambers weren’t that common until after 1930s
@absalomdraconis2 жыл бұрын
@@JCGver : Honestly, this mechanism is so simple & straightforward that a lot of them wouldn't even need schematics. Working out the correct _springs_ would likely be the hardest part.
@Nerdnumberone2 жыл бұрын
It's made for an arbitrary shotgun and shell. You need to calibrate a lot when affixing the mechanism and probably be consistent with whatever ammo you use. I think that careful calibration and luck in picking the right shotgun and ammo would be significant.
@1978garfield2 жыл бұрын
@@JCGver If they remake it they need to increase the capacity by lengthening the tube. Might as well make it barrel length. After they get that working they start on making it work the hammer automatically :)
@StopMoshin2 жыл бұрын
I'm surprised I haven't seen these in Hunt: Showdown, considering that they have something as niche and weird as the auto Mosin, which is a Huot conversion on a Mosin Nagant which wouldn't work for obvious reasons.
@ZezacleB2 жыл бұрын
I AM HERE SPECIFICALLY THINKING ABOUT HUNT Was loading up the game to see if the Romero had a Manual Hammer or not while scrolling through the comments. Absolutely love that someone else was thinking the same thing LOL
@MatigrisSH2 жыл бұрын
That on a Romero would be OP.
@andrewlavoie60342 жыл бұрын
You can make auto mosin conversions, the one ingame has only a few problems, but I mean Fedorov was doing it
@Skulgar3212 жыл бұрын
@@andrewlavoie6034 Avtomat is a general term for automatic weapons (AK, AN) the Fedorov is a ground up weapon. The mosin would require a bolt turning mechanism, the Fedorov is a recoil operated rifle.
@kaniodon2 жыл бұрын
I saw someone present this gun in the suggestion channel on the Discord a couple of months ago and it was swiftly downvoted to hell unfortunately
@edurmissa7 ай бұрын
I love thing like italian coffe makers, safety razors, pocket watches, zippo lighters, bar shifters for bikes, typewritters, steadycams. These are what I call rudimentary advanced, they are nowadays obsolete and are quite simple tools doing their purpose, but in fact they are quite clever, impresive relying in pure mechanicals and physics and that makes them shine. Now this things is one of the most rudimentary advanced tools I ever seen.... Ilove it!
@zachk.530 Жыл бұрын
I like the little groove in the brim of your hat from countless weapon recoils
@U6kCtBuN2 жыл бұрын
im almost certain the issues with loading in and out of the intermediate tube are an issue because of modern oversized shells causing increased spring tension and i would love to see this thing ran with ones closer to what was intended, just in case it could operate flawlessly a century old
@thamojster2 жыл бұрын
I was thinking it might be because hes not tilting the barrel downward so gravity can take it further than the spring can travel, it seemed like every smooth load he had he had that barrel angled further down, and every jam it was near level
@xferth2 жыл бұрын
Maybe just boring the tubes and new springs would let it load easier its hard to say without it all disassembled but man would it be cool to see a modern one running. but i think you right the shells are just a tad bit bigger. but the fact it does work close to 100 years later shows craftsmanship
@gavinperch9413 Жыл бұрын
I dunno a lot about guns but I was thinking that maybe brass shells might work better but that thought is based on my (possibly misinformed) recollection that old shotguns used brass or paper shells.
@conmcgrath7174 Жыл бұрын
Holy shite! I was just about to make a similar comment but read yours and got spared some embarrassment/ repetition? Shells in that time were most likely made with waxed cardboard, the more yielding edges (waxed) might have seen this thing run flawlessly. Cheers and Pax,
@FL0D0S2 жыл бұрын
There's only one thing I want more than high-speed footage of this, and that's for someone to mirror the design and bolt one to either side of a side-by-side double barrel!
@MrSheckstr2 жыл бұрын
Couple of problems with that concept…. Try shooting THIS thing left handed…. Now imagine trying to shoot it with devices hanging on both sides and not have then smash against each other when reloading
@MegaGaming112 жыл бұрын
I AM SO DOING THIS WITH A BREAK ACTION NERF GUN!
@Ki115witch Жыл бұрын
Hunt Showdown community sends it's regards!
@thedesignerblacksmith59538 ай бұрын
If you guys are interested in having one, the Sulun arms are making the modern version of it, the ST-601 "Auslof"
@JazzKazoo09302 жыл бұрын
For anyone wondering what the price in 1924 equates to now, $6 then is a bit under $100 and $20 then is about $325 now. So to buy a single shot break action and this add on would run you about $350 to $425 today as opposed to the $575 that the price of a factory repeating shotgun is equivalent to today
@cycoholic Жыл бұрын
So essentially still worth the bang for your buck. 😂👍
@travisdoe4663 Жыл бұрын
I would imagine a lot of people at the time already had a single shot shotgun.
@FirstGameFreak1000 Жыл бұрын
@@travisdoe4663 this is the real answer, repeating shotguns were a fairly recent invention. You could either spend $600 on a new one when the single shotgun you own does basically the same thing, just slower, or you could spend $100 to upgrade your single shotgun to something that even closer to the same thing as a repeating shotgun.
@OntarioBearHunter Жыл бұрын
the new versions of these are 399 Canadian
@garyslayton8340 Жыл бұрын
@@FirstGameFreak1000not really drones have existed since ww1 Its just a casw of convenince
@hootinouts2 жыл бұрын
As a mechanical designer, I had my doubts about this contraption but after watching you work it out in the field, I am duly impressed.
@SeventhGod7711 ай бұрын
The ability of Americans to make any weapon have more gun per gun is astounding.
@outsider8209 Жыл бұрын
Think this might be my favorite random gun thing I've seen, I love the idea and how efficient it is for someone's old diy project essentially
@Lodr222 Жыл бұрын
Well thanks for wishing a wonderful new year. But I didn't expect I would see so many wonders this year.
@groundscorecuisine99592 жыл бұрын
Im possibly more impressed with this than any other gun on this channel, and I've spent countless hours watching. Thanks for finally getting this footage out here bro. I love the complex engineering with no thought given to practicality. "we'll make it work, damn it!" I can just hear the guys designing this awesome thing
@jeffpayne46972 жыл бұрын
I think between modern design and manufacturing techniques you could do a modern version of it that would be pretty dope
@absalomdraconis2 жыл бұрын
And you know what? For bird or skeet shooting, this is every bit as practical as a single shot so long as you have the right length of shell.
@TheOrangeRoad2 жыл бұрын
This is cool af, but I still gotta give it to that 40 or so shot chain pistol, where the chain goes through the handle
@groundscorecuisine99592 жыл бұрын
@@absalomdraconis not really cuz you need to cock back the hammer too. Maybe some kind of crazy linkage?
@Nerdnumberone2 жыл бұрын
I'm personally impressed by the various attemps at repeating blackpowder weapons.
@johnbraadland95562 жыл бұрын
I always wondered if there was a left handed version of this, so you could mount one on each side of a double barrel shotgun.
@prjndigo2 жыл бұрын
Yes, but it wasn't production. You can actually mount one of these on a break double to keep firing the left barrel.
@This_is_my_real_name2 жыл бұрын
If you mount one on both sides of a shotgun it would work, except for your being unable to _fire_ the thing! (Recall the _reason_ he could not shoot it left-handed -- this would make it impossible to shoot left OR right-handed!)
@Bozar912 жыл бұрын
I wonder if you could bubba some onto a Chiappa Triple Threat.
@Ezekiel_Allium2 жыл бұрын
@@Bozar91 .... imagine a custom device for a liberator quad barrel
@russetwolf132 жыл бұрын
That's just the shotgun from Devil May Cry.
@TheHorzabora Жыл бұрын
That’s a really pretty loading mechanism. I don’t think it would be that hard to iron out some of the bobbles when loading, either. I really thought that was going to jam hard and fast, instead it has an immensely satisfying sounding and looking loading action. For extra credits, a detachable/easier to reload ammo tube would make the ultimate steampunk shotgun… … until the double barrel break action version is made.
@fryfrom98 Жыл бұрын
This is the coolest gun attachment ive seen by FAR. absolutely beautiful action
@forrestdevine23362 жыл бұрын
I love when Ian is very clearly excited to show us something wild.
@raygumm2 жыл бұрын
Love Ian's dedication to the shot hiding his terror over the guy seemingly breaking his Alofs loader! Great video as usual!
@matthaught47072 жыл бұрын
I'm amazed he lets me shoot any of his guns anymore.
@raygumm2 жыл бұрын
@@matthaught4707 you handled it exceptionally well. I would have been mortified. Would love to see outtakes of this episode!
@nitrokid Жыл бұрын
Such a cool design. Reminded me of the video game 'Hunt: Showdown'.
@casonbaumgartner81892 жыл бұрын
Ian makes my day better. Thanks for the great videos burh.
@maxanderson88722 жыл бұрын
This is exactly the kind of ahead of its time design that would work in a game like hunt showdown, especially since they already have a single shot break action gun
@Messmer_Sympathizer2 жыл бұрын
Very happy too see yet another hunt showdown player in the comments. I main the terminus, how about you?
@OverlordHD362 жыл бұрын
Oh no .. not a semi romero ... not like this ... :D I'd love it
@DoctorFrostbite1 Жыл бұрын
Congratulations, you just called it. Its in the upcoming update, basically a new variant of Romero 77 called Alamo
@higgins3227 Жыл бұрын
CONGRATS 6 MONTHS LATER AND ITS HERE IN GAME
@Dr._Nope2 жыл бұрын
This gun needs to be put into video games, it's so ridiculously cool! This thing looks like it should be hunting vampires and werewolves in Victorian England or something! 😂❤
@animanera892 жыл бұрын
If they ever make another Dishonored game with less stealth and more "boom" I NEED something inspired by this to be in it!
@theduckaholicgamer79762 жыл бұрын
Could even work as a Star Wars blaster or red dead redemption shotgun.
@axtondragunov17842 жыл бұрын
Edwardian England because queen Victoria died in 1909
@Murzac2 жыл бұрын
@@axtondragunov1784 Eeeh you can bend those rules a bit for this. Especially if you're making something with a steampunky vibe in the first place. Like if you put this thing in a victorian era steampunk game, nobody would bat an eye.
@-John-Doe-2 жыл бұрын
A little anachronistic but I don’t think it’s implausible for it to have been developed earlier. Of course virtually everything steampunk / fantasy is implausible anyway.
@Nagria21126 ай бұрын
@17:28 "Rally 'round the family With a pocket full of shells" good quote
@busterkoala5906 Жыл бұрын
That is such a cool and unique reload method, I love stuff like this
@NO_LOVE_LOST2 жыл бұрын
I get the steampunk associations, but I think this also fits really well into the fallout universe (or any post-apocalyptic setting). I can totally picture some survivors building this out of scavenged parts and various break-action shotguns (imagine a double barrel one with this system! ;D) to get the upper hand against raiders because more advanced weapons are rare and hard to maintain
@caliber5302 Жыл бұрын
It just works
@ledocteur7701 Жыл бұрын
yeah, it would be awesome in a fallout game, especially since there already is a fairly advanced weapon upgrade system that allows aesthetic modifications. someone should totally make a mod for it.
@NickC_222 Жыл бұрын
I would love if they put this in Fallout 5. We wouldn't get to see it until probably 2029, but still.
@dist0rted320 Жыл бұрын
Double barrelled with two mechanisms? DOOM guy approved.
@mcrwoell Жыл бұрын
It was recently added into hunt showdown, as an upgrade to one of the early game guns, the romero (a standard break action shotgun.
@custardavenger2 жыл бұрын
I'm sure when new, and with some fine tuning, that would cycle pretty well. There are lots of options to tune the device to match the gun its mounted on.
@mpetersen62 жыл бұрын
And places for it to get out of alignment. In a way it reminds me of the table saw I've got for just general use. It's got a sliding table that movable on the fence rails which are moveable all on a sheet metal box with an cast aluminum table. Cuts nice when set-up properly. But it is a real PITA to get set-up.
@papabarstow8565 Жыл бұрын
The noise it makes when it rechambers is so immensely satisfying
@yesthecrumbs5806 Жыл бұрын
I know they all started at their own times and all have their own separate channels but Forgotten Weapons, C&Rsenal, the great war chanel and anvil with mark have all seemed like one big group of people with similar interests but specialities in different fields of the same hobby
@mrjockt2 жыл бұрын
I’m pretty sure Othias did a video showing how this contraption worked a couple of years ago, it was a pretty short video just to show that it did actually work.
@nymfan19902 жыл бұрын
He did. I knew it looked familiar.
@cvmaniac72862 жыл бұрын
Yea, it was one of their breakdown videos if i remember right.
@LadyAnuB2 жыл бұрын
He did and here's the 2 videos on it: kzfaq.info/get/bejne/nrR5nsaSndGVhYU.html kzfaq.info/get/bejne/qsiIgqmc0rHdmY0.html
@vicarus27282 жыл бұрын
I bet this is the same gun
@mrjockt2 жыл бұрын
Got to admit, it’s unusual to see what we in the U.K. would class as a “Heath Robinson” (or a “Rube Goldberg” if your American) device for a firearm that actually works as advertised.
@_ArsNova2 жыл бұрын
This would be a fantastically cool device to fit on my old single-barrel 16-guage shotgun. Shame this Rube Goldberg of a device is long out of production.
@misanthropichumanist47822 жыл бұрын
Wonder if a modern version could be 3D printed?
@Bramble203222 жыл бұрын
@@misanthropichumanist4782 probably, 3d printed stuff is very fragile though.
@onpsxmember2 жыл бұрын
@@Bramble20322 That highly depends on the base material mix.
@TheVexCortex2 жыл бұрын
@@Bramble20322 3D printed parts are about 60% as strong as injection molded parts of the same material, so not as fragile as you think. The springs would need to be metal, and the pins would need to be metal, but I think everything else would be fine 3D printed.
@1101agaoj2 жыл бұрын
@@Bramble20322 proof-of-concept 3D printed AR receivers are a thing now
@revtmyers1 Жыл бұрын
Really appreciate you sharing this.
@elitewolverine Жыл бұрын
This has got to be the best, most fun, shotgun device I have ever seen. This is a tinkers, builders, dream. Post apoc, steampunk, etc....amazing.
@sqeeye31022 жыл бұрын
I've wanted to see one of these actually run for a very long time, thank you for showing it off for us. Also, my heart skipped a beat at 16:24 when it looked like 100 years of mouse trapping was finally over.
@alifr40882 жыл бұрын
"Oh you broke my alofs!"
@8bitarmory8462 жыл бұрын
I had no idea what to expect when I saw this comment
@matthaught47072 жыл бұрын
Imagine how MY heart felt!
@StrangerOman2 жыл бұрын
Love the click-clack and tube sounds while running the action. Clever, crude and yet awesome design.
@pmgodin3 күн бұрын
This a crazy, yet simple and working contraption. Quite interesting!
@GoblinGobbler20692 жыл бұрын
The only way I can describe the both the mechanism and process of firing this firearm is *delicious*
@crestfallensunbro60012 жыл бұрын
I've got to say, this does put a smile on my face, hats off to the original designer. For how wonderfully brilliant the whole action is, how well it works and how extremely nicely it has help up over time.
@fireaza2 жыл бұрын
This reminds me of the auto-loader upgrade for the shotgun in _Half-Life: Alyx,_ though this one is only slightly less ridiculous.
@lettuce73782 жыл бұрын
slightly
@ytilaeR_ Жыл бұрын
This thing is really really cool, I love awesome engineering like this, and it seems to have held up well. Amazing mechanics, sounds sweet too.
@ytilaeR_ Жыл бұрын
I think if you were to drop the barrel more down in in front of you, instead of holding horizontal and cycling the action, it wouldn't have so much trouble feeding and might be able to close first try. Just a guess though. Kinda like how you did it at 12:43, but tilting a bit more forward.
@ItzVeggie Жыл бұрын
Had to come back after seeing they added the new alamo in Hunt
@covodex5162 жыл бұрын
I love how Matt just straightup ripped the shotgun apart in his excitement
@matthaught47072 жыл бұрын
In my defense, I was left unsupervised. Seriously though, I about had a heart attack.
@mrhappyface41812 жыл бұрын
@@matthaught4707 Apparently gun jesus gives radial buffs to field repairs. It was up again quick.
@schiz0phren1c2 жыл бұрын
Surprised we haven't seen this beauty in a movie/series yet, that is an iconic mechanism!, awesome!, thank you again for another great video Ian!
@xpdatabase1197Ай бұрын
The sounds are so satisfying when the roload just works perfectly.
@BallschanovChugavich Жыл бұрын
WTF?! HUNT SHOWDOWN IN REAL LIFE!!!!
@PhycoKrusk2 жыл бұрын
Honestly, if you were in an environment where there weren't a lot of repeating shotguns, this would make you king of the hill. You've got at least 4 shots where you'll be faster than the next guy (unless they've got a double), and after that there's nothing to stop you from single loading until you get a couple minutes to top up. Pair it with a cartridge belt or a bandolier, and you've got a high speed, low drag shotgun in 1905. Could you win a 2-gun match against a proper repeater? It wouldn't be impossible, but most likely not. But that isn't really what it's for. In the intended role of giving you repeating firepower for hunting, it probably works great (unless you drop it in the mud), and like Ian said, a $10 topper and $15 Alofs device is substantially less expensive than a $35 pump, and if you inherited the topper, the savings are even higher.
@phant0m2332 жыл бұрын
It's an inexpensive home defense weapon, too. It's 5 rounds for less than a pump-action shotgun, for basically the same functionality. It's not quite as easy to reload, but if you need more than 5 shotgun shells in home defense then either you're a terrible shot or you have far more serious problems at hand.
@PhycoKrusk2 жыл бұрын
@@phant0m233 these devices are no longer being manufactured, and are quite rare these days. As it stands, a pump shotgun is going to be far less expensive than a brake shotgun with one of these. It would also be more reliable, and potentially have even greater capacity. There's certainly interesting from a historical perspective, but if I was setting up a home defense shotgun today, this would not even be on my list as a backup option
@ILLEagle_12 жыл бұрын
@@PhycoKrusk well I think he was talking about back in the day home defense, not modern day
@PhycoKrusk2 жыл бұрын
@@ILLEagle_1 back in the day, I think most people would be concerned about the device getting in their way while hunting. Yes, you can remove it if you don't need to use it, since it's just held on by the axis screw, but that would get old after a while. Still, this would be a significant force multiplier, and certainly I can recognize it for that
@phant0m2332 жыл бұрын
@@ILLEagle_1 I was actually talking about doing it today. Not necessarily with the same system, but with something new; the patent has likely expired anyways, which would put the design in the public domain.
@charles_wipman2 жыл бұрын
It's a really pimp device, i can't belive that after almost 100 years works so well; happy new year to you and your family too.
@bargainbin22 Жыл бұрын
That is awesome, I would love to have one on a old single shot. From 1 to 5 shots is a huge improvement. Also a fun little gadget one could learn to load faster.
@mbtrev Жыл бұрын
This is one of the coolest engineering pieces i have ever seen in my life Great video