Chromosome 16 - Genetically ginger

Рет қаралды 58,715

10 жыл бұрын

Ginger hair is often singled out, but whilst the visual difference is quite striking, when you look at the genetic code it's all but indistinguishable. The gene that can give rise to ginger hair is called melanochortin1 receptor (MC1R) and is found on chromosome 16.
As the Ri's red-headed CHRISTMAS LECTURES researcher Andrew Beale explains, this gene controls the kind of pigment that will be produced in a person's hair. The difference between brown hair and ginger hair is down to a single base change in this gene -- an example of a "single-nucleotide polymorphism" which, unusually, causes a visible difference in that individual. For an appearance trait that has long been picked upon, it turns out that ginger hair is really quite an insignificant difference amongst the 3 billion base pairs that make up our genome.
With thanks to BBSRC: bbsrc.ac.uk/
The Ri is on Twitter: / ri_science
and Facebook: / royalinstitution
and Tumblr: / ri-science
Our editorial policy: www.rigb.org/home/editorial-po...
Subscribe for the latest science videos: bit.ly/RiNewsletter

Пікірлер: 167

@TheCelticTrio 8 жыл бұрын

I think red hair is so pretty

@nateh5099 2 жыл бұрын

Yeah you want red hair for yourself but you would never date a ginger man

@nathanrayne 3 ай бұрын

@@nateh5099I do

@bashkillszombies 10 жыл бұрын

I know his main point isn't the bullying aspect; but as a non-redhead I've often been utterly fucking disgusted with the treatment of redheads out there and have been in a couple of serious punch ups as an adult in the defense of a redhead. If it were any other genetic element it would be a race related hate crime, and IMHO I'd argue that bullying a redhead is just the same as bullying someone based on their skin color.

@dominiqueblagojevic9447 4 жыл бұрын

What if you have dark brown hair but it shines a reddish color on the sun?

@Scixxy 10 жыл бұрын

I think if I'd proffered this explanation as a kid to avoid mockery, I'd have been even more mocked. Although... Once a bully asked me, "Why are you so weird?" I answered, truthfully, "partially upbringing and partially genetics." His response? "What the f*ck is a 'genetic'?" I think, in retrospect, bursting out laughing may not have been the most politic response, but it was unexpected enough to briefly stun the bully to silence as I made my escape, gasping for air.

@kehroro 10 жыл бұрын

but he didn't highlight the 'non-ginger' part on the other page.... i am suspicious, but ill take your word for it.

@dimduk 10 жыл бұрын

I'm bald as a cue ball,I'd be happy to have hair of any color.

@melonsoda123 7 жыл бұрын

I hope your kid(s) have ginger hair, as well. So beautiful.

@richmanpoman1 10 жыл бұрын

Minute differences are HUGE when it comes to DNA, don't make light of "minute" differences. Redheads are obviously extremely different.

@dodgerstone 8 жыл бұрын

I have always loved redheads then I had a redhead son...Redheads are so incredibly beautiful! Cheers!

@zoeyhaskell5892 3 жыл бұрын

Oh thank you. ^^

@YOSUP315 5 жыл бұрын

Hating on gingers needs to be stopped, I agree there. But the mere fact, it's just a single SNP is irrelevant, because that one tiny change produces such a large phenotypic difference. I'd rather point out how special and rare this one SNP is, and how beautiful it makes your hair.

@HiAdrian 10 жыл бұрын

Gingers should be cherished as a national treasure, shame on you Britain. Not many countries have them.

@TheCelticTrio 8 жыл бұрын

I want to change my hair to ginger

@shaunnoble4513 5 жыл бұрын

Adrian please dont be so socialy conditioned and stupid as to call us plants

@JACKDAWFISH 3 жыл бұрын

The US actually has the most gingers in the world.

@Linz0440 3 жыл бұрын

@@JACKDAWFISH Not percentage of population it doesn't.

@blenderpanzi 10 жыл бұрын

I don't understand why people pick on red haired people. It seems to me a thing in Great Britain but not so much in the rest of Europe, or is it just my social bubble? I think red hair is the most beautiful hair color there is (on women; can't say about men)!

@Nlenov 10 жыл бұрын

Best RI advent calendar episode so far.

@lohphat 10 жыл бұрын

Does the single BP also control the freckled pigmentation or are those other genes which simply tend to follow along with hair color?

@Limposium 10 жыл бұрын

So it does not seem stupid to pick on someone for larger genetical differences?

@lja1229 4 жыл бұрын

I'm just now as an adult stared embracing and rocking my ginger-ness!

@Sedow1231 4 жыл бұрын

0:16 you utterly depressed face, that the only feature that caught my eyes, bro are you okay now???

@haroldjones9321 2 жыл бұрын

Astounding content. Thank you so much.

@kashfiaislam9995 2 ай бұрын

Rapper Machine Gun Kelly is a natural redhead but bleaches his hair platinum blonde. 🎨🥁🎸

@MarkPhilpott 10 жыл бұрын

Very interesting. Nice video. Hope you won the bet for that jumper ! ;o)

@Missnaughty011 10 жыл бұрын

No one should pick on someone who has ginger hair. I think it's beautiful coz it reminds me of ginger cats.

@VBfamilyadventures 6 жыл бұрын

This is quite interesting. My daughter is a "ginger." We also found out that my son and I (both blonde) have a rare genetic difference called 16p11.2 microduplication. So, to find out that the ginger gene I passed to my daughter, also comes from the chromosome 16, is quite interesting.

@hummingbird2254 3 жыл бұрын

My dad was strawberry blonde with freckles. I had light brown hair as a child, and then my hair turned auburn as a teen, and I have his freckles.

@notexactlypaul 10 жыл бұрын

Only a ginger can call another ginger ginger.

@SparkyOne549 3 жыл бұрын

I was natural auburn that really came into affect as my tween to adult years...so did all the freckles. So my hair was brown inside, bright orange In the sun..... it used to freak out my school friends and teachers lol thankfully I was never teased, most people were shocked lol. My maternal grandmother was a red head. As an adult, I have the red hair type freckles where I get the sun. As a teen I had a red hair friend, who said I looked just like a red head because of the freckles, then she saw my hair in the sun...and said I was a red head lol.

@zpottsy 4 жыл бұрын

My mother was redhead, my girl friend (common law wife) is redhead, and my daughter is redhead. Other than being redheads as a common denominator. They are Knock Out Damn Good Looking with cool personalities.

@Distracted 7 жыл бұрын

My hair is brown but for a few red strands I sometimes find. I also have orange-reddish hairs in my beard. Could this mean I have something related to the so-called red hair gene in me that's active? Or could it mean something else? I should add that my father's hair is said to have been red when he was a kid, but it turned brown early in his life.

@Cats3to2 5 жыл бұрын

Because your father had red hair, you carry the gene mutation but it is mostly inactive in you. If you marry a redhead or someone with an inactive gene mutation you will have a chance at having redheaded children.

@michaelcandido2824 Жыл бұрын

It means you have at least one of the two genes needed

@dizmop 2 жыл бұрын

why are Gingers sop associated with the British isles?

@haroldjones9321 2 жыл бұрын

@ Robert Farr ...I can relate to your comments. Now 71 years old white male with gray/blue eyes and reddish tint to exposed skin. Burn and cannot tan. Blonde when a child. Became strawberry, Reddish to brown beard. Now beard is silver. Hair is dark brown to black. So I conclude that I share in the MC1R club.

@marshacreary2442 5 жыл бұрын

Fascinating

@xotoxpv 10 жыл бұрын

When he showed us the paper, I was sure it is something like 1 or 2 pairs :D

@andrewbeale1005 10 жыл бұрын

Have a look for yourself ;-) Non-ginger:ATGGCTGTGCAGGGATCCCAGAGAAGACTTCTGGGCTCCCTCAACTCCACCCCCACAGCCATCCCCCAGCTGGGGCTGGCTGCCAACCAGACAGGAGCCCGGTGCCTGGAGGTGTCCATCTCTGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAGCTTGGTGGAGAACGCGCTGGTGGTGGCCACCATCGCCAAGAACCGGAACCTGCACTCACCCATGTACTGCTTCATCTGCTGCCTGGCCTTGTCGGACCTGCTGGTGAGCGGGAGCAACGTGCTGGAGACGGCCGTCATCCTCCTGCTGGAGGCCGGTGCACTGGTGGCCCGGGCTGCGGTGCTGCAGCAGCTGGACAATGTCATTGACGTGATCACCTGCAGCTCCATGCTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCTACATCTCCATCTTCTACGCACTGCGCTACCACAGCATCGTGACCCTGCCGCGGGCGCGGCGAGCCGTTGCGGCCATCTGGGTGGCCAGTGTCGTCTTCAGCACGCTCTTCATCGCCTACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGCAATGCCATCATCGACCCCCTCATCTACGCCTTCCACAGCCAGGAGCTCCGCAGGACGCTCAAGGAGGTGCTGACATGCTCCTGGTGA Ginger (the variant we used in the video):ATGGCTGTGCAGGGATCCCAGAGAAGACTTCTGGGCTCCCTCAACTCCACCCCCACAGCCATCCCCCAGCTGGGGCTGGCTGCCAACCAGACAGGAGCCCGGTGCCTGGAGGTGTCCATCTCTGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAGCTTGGTGGAGAACGCGCTGGTGGTGGCCACCATCGCCAAGAACCGGAACCTGCACTCACCCATGTACTGCTTCATCTGCTGCCTGGCCTTGTCGGACCTGCTGGTGAGCGGGAGCAACGTGCTGGAGACGGCCGTCATCCTCCTGCTGGAGGCCGGTGCACTGGTGGCCCGGGCTGCGGTGCTGCAGCAGCTGGACAATGTCATTGACGTGATCACCTGCAGCTCCATGCTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCTACATCTCCATCTTCTACGCACTGCGCTACCACAGCATCGTGACCCTGCCGCGGGCGCGGCGAGCCGTTGCGGCCATCTGGGTGGCCAGTGTCGTCTTCAGCACGCTCTTCATCGCCTACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGCAATGCCATCATCCACCCCCTCATCTACGCCTTCCACAGCCAGGAGCTCCGCAGGACGCTCAAGGAGGTGCTGACATGCTCCTGGTGA Paste them into BLAST's alignment tool and find the difference blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq

@debo4055 3 жыл бұрын

I was born a bright yellow with with an orange glow around my crown then it became a lot brighter. I now have an a proper copper beard growth and golden/ strawberry hair that gets brighter in the sun

@haroldjones9321 2 жыл бұрын

~2:47. The "C" base pair of red hair. "One base pair difference out of the three billion that make up our genome" is the genetic source of red hair. Well said professor.

@ichbinein123 10 жыл бұрын

Picking on others, based on their haircolor, is really fucking low. Several of my friends are red-haired, and they say that it hurts more than one should think, when people point out their hair color, as a derogatory mean. It's not as much a "Joke" as you might think it is.

@MrConorWB 10 жыл бұрын

I have ginger hair but would not get offended if someone said something about it. You only get offended by things that you think are true. Plus, it make for a conversation starter.

@Samuel115s 7 жыл бұрын

IchBinEin it's not surprise. people will pick on people for the most silly things ever. ever head of racism or colourism.

@biskitz86913 3 жыл бұрын

Thats all in the eye of the beholder. I never minded getting ripped for being ginger. Kids can be mean, about your weight, glasses, heritage anything really. Ginger is no different. Sticks and stones and all that, I always thought that if words offend you, youre complicit in it.

@haroldjones9321 2 жыл бұрын

The variety in the human genome is astounding and is an enhancement in the potential surviability of the human species. Perhaps one can relate better by considering the variety in plants, fruits, nuts, vegetables, animals or basically all life on earth that has survived. No one really thinks that is odd or bad. In fact many strive to give expression to the latent genetic poof of possibles. Variety!

@jrw6362 3 жыл бұрын

I have ginger hair and I was called GT for Ginger Tosser.

@fullyawakened 10 жыл бұрын

1:45 Let me guess, that "C" gets changed to a "G"?

@andrewbeale1005 10 жыл бұрын

Almost. I was actually highlighting the ginger hair variant, which has a C. The non-ginger variant has a G. Amino acid-wise the transition is from GAC (Aspartic acid) to CAC (Histidine). But like I say, this is just one of the changes!

@user-rn9jk8jt9m 3 жыл бұрын

0:15 why are his eyes like this

@luanadourado5740 5 жыл бұрын

Legenda em português

@Incantationem 3 жыл бұрын

Interesting that the genetic difference is so minute, but I don't think it will stop bullying, since reasons for bullying are generally just superficial excuses.

@mayra2651 5 жыл бұрын

Ginger guy are beautiful

@nikolaospeterson2495 7 жыл бұрын

You are Ginger, I am ginger and you are CUTE! All because of our common mutations of MC1R! Nice!

@tarassu 10 жыл бұрын

Yes it is.

@morlanius 10 жыл бұрын

Any explanation as to why the number of people with ginger hair is growing every birth generation. The number in recent years is growing on a exponential rate.

@morlanius 10 жыл бұрын

***** lol that's funny but kind of subverting my proposed conversation away from its context and into the realm of make-believe and encouraging hate speech.

@andrewbeale1005 10 жыл бұрын

Do you have a reference for that stat? Also, what do you mean by 'birth generation'?

@stoltobot 10 жыл бұрын

Morlanius actually, it is kind of sad. Some geneticists predict the mutated MC1R expression to become extinct in 50-100 years. Gingers are breeding into more diverse populations with lower incidence of red hair. Sperm banks are even turning away ginger haired guys.

@stoltobot 10 жыл бұрын

stoltobot +Morlanius Apologies, it was actually bullshit research (science.howstuffworks.com/life/genetic/redhead-extinction.htm). The sperm bank thing I don't know.

@joannechisholm4501 5 жыл бұрын

My dad, it ginger but I don't have the Mc1r Gene im just a dirty blond?

@Cats3to2 5 жыл бұрын

If your dad has red hair you do have the Mc1r gene but it is inactive. If you marry someone else with red hair or someone else with the inactive gene, you will have a chance at having redheaded children.

@MuadDib1402 10 жыл бұрын

0:20 I see you're at the Baron's traffic light.

@andrewbeale1005 10 жыл бұрын

We filmed on two central reservations around these lights on Regent's Street Regent Street, London, United Kingdom

@rrozinak 10 жыл бұрын

No Doctor Who references? I'm disapointed.

@douglashendrix1006 8 жыл бұрын

I think Ginger Hair is so lovely. But then again I am a Ginger and so is me mum.... LOL

@katelin8682 7 жыл бұрын

same

@smith092 10 жыл бұрын

Wow! Had no idea red hair could be caused by a SNP.

@williammoseby7274 2 жыл бұрын

Reds are very different from the rest I should know. Never been laughed at or teased.

@aiheartbeat593 7 жыл бұрын

his hair is blonde ._.

@akashashen 10 жыл бұрын

Go Cytosine for the Win!

@onlyCreativity 10 жыл бұрын

No, it doesnt seem to be stupid at all. I mean in this case it is but it doesnt seem so.

@facefirst5034 6 жыл бұрын

Wow, you got a very lucky wife to marry a sweetheart like you!

@valentine93 9 жыл бұрын

While i visited my grandmother last weekend my uncle was talking about how they had Spaniard Jewish Ancestry on my fathers side of his family and then he talked about my grandfather and i had made jokes about gingers but what he told me was a slap to the face! My grandfather was a ginger ("day walker") hmm i come from a strange back ground, always nice to know things about my family.

@valentine93 9 жыл бұрын

UniversalPotentate that it explains a lot ! Good night ANTHONY! lol

@RandyR 9 жыл бұрын

What does it really matter what ones race is? I am part Irish,German an Indian. We are all one race. Human. We most learn how to look past the differences. We all bleed an hurt the same.

@valentine93 9 жыл бұрын

Randy R true but i like to know my family's history, i have no clue i can only trace down to my great grandfather and that's why i was surprised that my grandfather was a ginger lol

@valentine93 9 жыл бұрын

UniversalPotentate lol well... That happens people can't handle your awesomeness you're too much :P

@valentine93 9 жыл бұрын

UniversalPotentate pretty much. Lmao

@ekbergiw 6 жыл бұрын

He looks like Meekakitty's brother

@arenh2049 3 жыл бұрын

This is clearly just a clever anti-bullying ad for gingers!

@HexerPsy 10 жыл бұрын

So then gingers have no soul, because of one single base pare error? god shouldve found a better place for the soul gene. /troll thanks for the explaination! ima have to search later how other hair colors arise from genes.

@Sonieta03. 3 жыл бұрын

I want to be ginger, lucky you

@epicon6 3 жыл бұрын

0:52 red hair is also thicker than brown hair. Because it's thicker people with red hear have about 90 000 strands of hair, blondes 110 000 and brunettes 140 000.

@mooxim 10 жыл бұрын

If that one gene is all it takes, has there ever been a documented case in recent years of a spontaneous ginger mutation in a human child without ginger ancestry?

@simonj48 10 жыл бұрын

Yes, they're called ginger step children. They get hit a lot.

@floriangrey 7 жыл бұрын

mooxim Wow 3 years anyway I'm the only redhead in my family, both sides. Nobody in my family has knowledge of other redheads. Questions have arisen by family members about me being a real family member! True story. My brother had white hair the first 3 years of his life but his hair turned blond/brown afterwards probably because his body suddenly started to produce colr pigment.

@MrRobertFarr 3 жыл бұрын

I think, I am pretty handsome. There's hair all over folks bodies. I have both dark brown and ginger hair. When, I cut my head hair off, and look at it. It appears dark brown. Almost black. But my beard is ginger. Hair on my arms is actually ginger. But, I imagine that it's blonde. It's actually difficult to spot the hair, on my arms or face, because it's light in colour. Perhaps, I am the missing link to the origins of shaving? I like to think so. It's a way ginger men, perhaps can bully our brunette cousins. Because, shaving is such a waste of time. People are often encouraging me to shave. But, I think I get away with less shaving as ginger hair is less noticeable. 😉 So, in becoming positive about one trait, I am perhaps being negative about other traits. But self love is certainly important and, well I like to think certain traits are perfect for certain environments. Different niches in the ecological food web. Something like that anyway it's difficult to explain. There's a home for most folks and, it's best to fall in love with your own appearance. Admire the appearance of others. The worrying thing is where people with ginger head hair are bullied and perhaps dye their hair with potentially damaging chemicals.

@ValentinoHudhra 10 жыл бұрын

The guy seems still annoyed..

@mattMcLovinisbae 10 жыл бұрын

zcool intro

@blitzkrieg3546 3 жыл бұрын

I myself have dark red hair . I’m ok with it . , As a kid I hated the bad jokes relating to my hair color . I also hate the British term Ginger . Being a American I dislike that word ! At lease I’m not bald , I’ve got a full head of hair . 😀😄😆

@Cats3to2 5 жыл бұрын

Royal Institute hair can only be properly viewed in a Tricoscope. Only a Tricoscope can show the racial differences in hair. And hair color isn't the only thing different in redheads. Our skin is different. ANd there are more subtle differences.

@robertavila1863 Жыл бұрын

2:24 phenotypes vs. genotypes :D

@marcv2648 3 жыл бұрын

We don't judge each other by our genotypes, we judge each other by our phenotypes. Scientists think genetic information in the hands of the public makes a difference. It doesn't.

@kevinmcnally4047 6 жыл бұрын

Your red hair hue is not even that striking. There are gingers with much brighter red hair.

@yeshuasage3724 9 жыл бұрын

but isn't it true that ginger hair is also usually paired with pale skin and freckles to some extent, thus resulting in as sort of "weird" look [no offense]. i went to school in wales uk, and ginger kids were the most ridiculed.

@astronomyguy976 9 жыл бұрын

Yeah just like N***** no offensive

@yeshuasage3724 9 жыл бұрын

Haakon Johansen ????//

@StarPowerxxx2 10 жыл бұрын

My ginger hair comes from my mum's dad's brother.

@biskitz86913 3 жыл бұрын

No it comes from both sides of your family as it is double recessive. Both of your parents need to have the gene and even then there was only a 25% chance you would have red hair.

@YouJustGotGerrowned 10 жыл бұрын

Just one letter away from being soulless...

@gaara33373 10 жыл бұрын

It's just a HAIR COLOR for god sake! ==" For you to believe this makes him soulless, then I guess you don't have any functioning brain cells.

@n_adoui 10 жыл бұрын

Elly Gaara if you had a functioning brain you'd have noticed that it's a JOKE

@gaara33373 10 жыл бұрын

I bet people who hear that "JOKE" all the time don't think it's FUNNY!! =_=

@Crossark1 10 жыл бұрын

Elly Gaara This is actually completely true. I have friends I love more than anything on the planet that say this to me twice a day at least. It's really fucking hurtful to people with read hair.

@The40thThief 10 жыл бұрын

Elly Gaara Set them straight and tell 'em that there is no soul. It does not exist, at its best it is a synonym for the higher functions of the brain which are in no way incorporeal.

@xapemanx 10 жыл бұрын

i thought gingers were supposed to have red hair ... :3

@brangrah1717 10 жыл бұрын

no soul

@jdbgrizz 10 жыл бұрын

Is it true that gingers are the rarest race on Earth? I have heard this. and it would seem so..... also, there is evidence that the Neanderthals had ginger hair ;)

@RBuckminsterFuller 10 жыл бұрын

"Race"?

@jdbgrizz 10 жыл бұрын

there is no such thing as "white people" and Caucasians come from the Caucasus mountains. not all Europe. are you offended by diversity?

@Scixxy 10 жыл бұрын

Jordan Benson Presumably he or she is simply confused by your calling ginger-haired people a race. Your reply is ... baffling.

@stoltobot 10 жыл бұрын

Jordan Benson that is true that an expression of red hair has been found in neanderthals but the evidence points towards it stemming from a different mutation than that of modern gingers.

@jdbgrizz 10 жыл бұрын

please give a reference :)

@robster6681 9 жыл бұрын

U MOT M8

@rihardsso4612 5 жыл бұрын

so funny xD

@Alex6.9 4 жыл бұрын

No soul

@GVAjaxNow 10 жыл бұрын

Ohhhhh. Bitter. Quite chilling when they look right at you, other worldly almost, like Opossums.

@enihil7713 5 жыл бұрын

Why is he so insecure about his hair?

@shaunnoble4513 5 жыл бұрын

You shouldnt call us gingers. We are people. Not plants. Think more. Watch tv less

@Germany097 2 ай бұрын

Yeah that’s right

@MrRobinhalligan 10 жыл бұрын

that is one hideous jumper

@andrewbeale1005 10 жыл бұрын

I'll let my colleagues know - they chose it for my birthday.

@BiGbEaR2070 10 жыл бұрын

i'd probably pick on him even if he didn't have ginger hair..(ohh im soo evil ^^)

@Satrif 10 жыл бұрын

that one letter is a signature for selling your soul to the devil. Thats how you become ginger.

@Andrew_Sparrow 10 жыл бұрын

But we are not picking on you because of your pairs... it's because of your hairs :p Couldn't you wear a hat or something? or a bandana ;)

@Crossark1 10 жыл бұрын

Picking on someone is the same, no matter what it's for. It's stupid, and rude. Making a joke out of a living being for something they aren't able to control when they come into the world, and probably won't be able to until they move away from their parents because many parents aren't willing enough to let their kids do away with potential years of torment because they don't want their child associated with people who dye their hair. So next time you notice something different about someone, don't try to make a joke out of it. People have different senses of humor, after all. You're bound to piss someone off no matter how you phrase it.

@Andrew_Sparrow 10 жыл бұрын

Crossark1 Don't have to dye it... They could shave it off and say they have cancer, that wouldn't be as bad as ginger hair...

@Crossark1 10 жыл бұрын

Andrew Sparrow Yeah, a complete and utter genetic fuckstorm that's killed millions on millions of people this year alone is waaaaaay better than a fucking C where it's not supposed to be. And don't even try to say that that was a joke. That's right up there with joking about 9/11 and religion. You're gonna get shit for that no matter what, and no one really finds it funny.

@Andrew_Sparrow 10 жыл бұрын

Crossark1 lol.. you make taking candy from a baby sound hard... :p wonder if there were any ginger ppl in 9/11 ?