How Much Data Can Our Brains Store?

  Рет қаралды 201,755

SciShow

SciShow

4 жыл бұрын

Our brains aren't exactly like a computer's hard drive, but it can still be fun to think about just how much storage space we have in our noggins.
Hosted by: Olivia Gordon
SciShow has a spinoff podcast! It's called SciShow Tangents. Check it out at www.scishowtangents.org
----------
Support SciShow by becoming a patron on Patreon: / scishow
----------
Huge thanks go to the following Patreon supporters for helping us keep SciShow free for everyone forever:
Eric Jensen, Matt Curls, Sam Buck, Christopher R Boucher, Avi Yashchin, Adam Brainard, Greg, Alex Hackman, Sam Lutfi, D.A. Noe, Piya Shedden, Scott Satovsky Jr, Charles Southerland, Patrick D. Ashmore, charles george, Kevin Bealer, Chris Peters
----------
Looking for SciShow elsewhere on the internet?
Facebook: / scishow
Twitter: / scishow
Tumblr: / scishow
Instagram: / thescishow
----------
Sources:
kb.iu.edu/d/ackw
www.ncbi.nlm.nih.gov/pmc/arti...
www.ncbi.nlm.nih.gov/pmc/arti...
www.ncbi.nlm.nih.gov/pubmed/1...
www.scientificamerican.com/ar...
elifesciences.org/articles/10778
aiimpacts.org/scale-of-the-hu...

Пікірлер: 827
@Paul-A01
@Paul-A01 4 жыл бұрын
150 TB and half of them are used for embarrassing memories from high school.
@cezarcatalin1406
@cezarcatalin1406 4 жыл бұрын
All of them stored in 16K 3D stereo ultra HD with extra metadata
@TerrariaGolem
@TerrariaGolem 4 жыл бұрын
@@cezarcatalin1406 :o That was a pretty good expansion of the pun. :D
@uss_04
@uss_04 4 жыл бұрын
The answer is to "stop it" just remeber to forget the memory and stop reenforcing that synaptic path /s
@svenmorgenstern9506
@svenmorgenstern9506 4 жыл бұрын
Not to worry - by the time you hit 50, you'll have forgotten pretty much all of it. Except for that asshat in English - that sucker's memories will ALWAYS be there. 😬
@lazerwing3022
@lazerwing3022 4 жыл бұрын
and the other half are memes and stupid facts
@Speak_Out_and_Remove_All_Doubt
@Speak_Out_and_Remove_All_Doubt 4 жыл бұрын
I think I have ran out of space as when I taught myself how to make homemade beer I forgot how to drive.
@darkdialga777
@darkdialga777 4 жыл бұрын
One of my favorite Simpsons jokes, thanks for reminding me. :)
@KevinP32270
@KevinP32270 4 жыл бұрын
wait...what? lololol
@Speak_Out_and_Remove_All_Doubt
@Speak_Out_and_Remove_All_Doubt 4 жыл бұрын
@@darkdialga777 Classic Simpsons, the early series were all pure gold.
@libertyprime2928
@libertyprime2928 4 жыл бұрын
Niceeeee😂😂😂
@radhikakamath356
@radhikakamath356 4 жыл бұрын
Speak out and remove all doubt! A
@annonimooseq1246
@annonimooseq1246 4 жыл бұрын
I wonder what KIND of information is hardest to store/ takes up the most “data” because I can recite schoolhouse rock songs that I haven’t listened to in like a decade, but can’t remember how to spell simple words
@98Zai
@98Zai 4 жыл бұрын
Our brains deem things with emotional associations very important. Negative emotions are especially significant; it's more important to remember and be able to avoid uncomfortable situations than to seek constant happiness at the cost of survival chances. Spelling is boring and unemotional. Listening to music is awesome and fun and probably has a positive social connotation for your brain :)
@pauldeddens5349
@pauldeddens5349 4 жыл бұрын
@@98Zai Emotion definitely plays a large part, since emotion and memories go hand in hand Its hard to try and think of memories with no emotion, unless they are things like how to write words
@mikefelber5129
@mikefelber5129 4 жыл бұрын
Annonimoose Q Motor memories are stored deepest as they deal with movement. That's why there is the saying that something is 'just like riding a bike' bc that kind motor coordination learned early will stay with you.
@user-fd6bd2hk1p
@user-fd6bd2hk1p 4 жыл бұрын
Brain is association machine. Linked information is good, abstract and isolated is bad.
@bialynia
@bialynia 4 жыл бұрын
I heard that the strongest emotions are the ones associated with smells.
@DJH316007
@DJH316007 4 жыл бұрын
But how much of the brain's space is taken up by the Operating System?
@Laezar1
@Laezar1 4 жыл бұрын
I would say the operating system is the brain structure itself. So it's not stored anywhere. Like, the brain doesn't interact with itself to run a routine to imprint a memory for exemple (which computers do), the memory imprinting is just a natural result of the brain working.
@ax--media
@ax--media 4 жыл бұрын
Maybe about 50%? 😂😂😂
@gamesman0118
@gamesman0118 4 жыл бұрын
You are the OS. So every part of the brain is the OS. Your memories and learning shape who you are.
@SyukriLajin
@SyukriLajin 4 жыл бұрын
For some, probably alot, seeing how some people are soo full of themselves.
@LetsAllLoveLain_
@LetsAllLoveLain_ 4 жыл бұрын
The boot ROM would be the brain stem
@dennisvance4004
@dennisvance4004 4 жыл бұрын
You know you’re in trouble when you close your eyes and see the message “iCloud backup was unsuccessful”.
@KevinP32270
@KevinP32270 4 жыл бұрын
lolol
@Azaelris
@Azaelris 4 жыл бұрын
When your data gets corrupted randomly. You think of something else and immedietly forget what you were thinking about. I hate it so much
@frankschneider6156
@frankschneider6156 4 жыл бұрын
Whoever is stupid enough to pay premium prices for Apple products has far worse problems, than just data loss.
@dennisvance4004
@dennisvance4004 4 жыл бұрын
Frank Schneider thanks for inserting your ignorant, bigoted remark into what was simply a joke. Get a girlfriend, you’ll feel better about yourself.
@frankschneider6156
@frankschneider6156 4 жыл бұрын
@@dennisvance4004 The truth hurts, does't ?
@pigpuke
@pigpuke 4 жыл бұрын
"Give your brain some credit, it's probably pretty spacious." That sounds like a backhanded compliment. :P
@TheCatAteMyShoe
@TheCatAteMyShoe 4 жыл бұрын
LOL: Airhead!
@Moonz97
@Moonz97 4 жыл бұрын
I must've missed the recent update. My memory size is still 32MB...
@frankschneider6156
@frankschneider6156 4 жыл бұрын
640KB out to be enough for everyone
@Guardrailkid
@Guardrailkid 4 жыл бұрын
Laughs in 7kb
@Vivek-qz9br
@Vivek-qz9br 4 жыл бұрын
64bytes: hold my chips
@BayAreaPolice
@BayAreaPolice 3 жыл бұрын
Ok
@ikaiokahokubyyen9788
@ikaiokahokubyyen9788 4 жыл бұрын
Short answer: We don't know.
@larrydavison8298
@larrydavison8298 4 жыл бұрын
We don't really understand how our brains store memories.
@Kevin-sy8uf
@Kevin-sy8uf 4 жыл бұрын
@@larrydavison8298 We don't really understand how anything works. Why are we here rather than not?
@Kobolds_in_a_trenchcoat
@Kobolds_in_a_trenchcoat 4 жыл бұрын
@@Kevin-sy8uf I'm here because I just took a shower and would like to dry off. You?
@o76923
@o76923 4 жыл бұрын
It's probably more like "Short answer: Is red faster than 7?" The mechanisms of action are so different that it is difficult to compare them meaningfully.
@scottcupp8129
@scottcupp8129 4 жыл бұрын
Not only does it store data, it keeps us breathing, thinking, our senses working, typing this message, and laughing at cat memes. So much more than just a storage device.
@moussatahirou1531
@moussatahirou1531 2 жыл бұрын
those are in the ram on the brain
@deafbyhiphop
@deafbyhiphop Жыл бұрын
Intelligent design. Not evolution
@emten1584
@emten1584 10 ай бұрын
​@@deafbyhiphopbased on what evidence?
@theonepath7865
@theonepath7865 4 жыл бұрын
Me: my memory is so bad I forget bits when I wake up the next day, my PC is so good at storing information - so jealous. RAM: am I a joke to you?
@Zero-pe3iq
@Zero-pe3iq 4 жыл бұрын
Eye witness testomony "I dunno man I think it was black guy with no hair." Cameras later found to have footage of the incident "I was a white male of about 35 years of age with full head of hair and a number of grey hairs, brown eyes, etc" Hell at least when a file is corrupted in PC it can be restored and yet with a lot more processing power and millions of years of evolution the human brain can only sometimes(people with crazy and rare impressive memorories) be nearly as good at storing and accessing accurate information that it evolved for millions of years. The human brain has been running on massive amounts of processing power for hundreds of thousands of years and evolving(microevolution) the whole time and computers have only been around for about 70 or so years and are often much better at many specific tasks.(assuming there is intelligent life imput anyway)
@michaelbuckers
@michaelbuckers 4 жыл бұрын
DRAM can forget data if you don't remind it about it in as little as 64 milliseconds.
@AFishBicycle
@AFishBicycle 4 жыл бұрын
A joke that Hertz 😉
@Zero-pe3iq
@Zero-pe3iq 4 жыл бұрын
Thanks for the likes!
@taro.s
@taro.s 4 жыл бұрын
Yet exams are coming up, and everything I read my brain’s just like “Ya know, I _could_ store this. But *why* would I use up VaLuAbLe SpAcE on that”
@undr_guv_surv
@undr_guv_surv 4 жыл бұрын
Your brain also stores the firing patterns for all the neurons too(memories, actions, etc)
@bennedictobsioma1367
@bennedictobsioma1367 2 жыл бұрын
You know the brain is more complex than i think it is
@randomlocalpigeon8787
@randomlocalpigeon8787 4 жыл бұрын
Every time she said “synapses” i head “synapsids”, and now a cant get the image of tiny dimetrodons crawling around on neurons out of my head....
@greensteve9307
@greensteve9307 4 жыл бұрын
Hahahaha!!
@tj4234
@tj4234 4 жыл бұрын
0:13 that HD won't store anything if you keep holding it that way 😂
@zachcrawford5
@zachcrawford5 4 жыл бұрын
The ways that brains compress and recompile "memories" and other data is also very different than a digital computer.
@legienterprise5307
@legienterprise5307 10 ай бұрын
its probably not digital?
@SquirrelASMR
@SquirrelASMR 4 жыл бұрын
I can hold one hundred and ten datas in my brain
@williandalsoto806
@williandalsoto806 4 жыл бұрын
I dOnT gEt iT mAn...
@SquirrelASMR
@SquirrelASMR 4 жыл бұрын
@@williandalsoto806 that's a biggest number I know
@zack7122
@zack7122 4 жыл бұрын
that"s Verr y good'f â sqriell. .. :
@Azaelris
@Azaelris 4 жыл бұрын
@@zack7122 lol
@frankschneider6156
@frankschneider6156 4 жыл бұрын
There is just one Data (Lore doesn't count)
@xhawkenx633
@xhawkenx633 4 жыл бұрын
What's interessting about how our memory works is, that our brains are capable of compressing data indefinitly. Your short term memory usually is capable of holding 4-5 "items", that means 4 or 5 slots for your brain to store information in. If I asked you to remember 5 numbers for example just: 1;2;3;4;5. Your memory would be full. Asking you to remember another number would result in you losing one. Now however if you compress those Numbers to one Number for example:21345. You still remember all 5 Numbers just compressed into one. And you could do that with everything as long as you find a way to combine the things you try to remember into one "item". Basically association
@LimeyLassen
@LimeyLassen 4 жыл бұрын
Right! It's all about compression. In practice brain storage could be infinite, it just gets more compressed and tangled the more you learn.
@frankschneider6156
@frankschneider6156 4 жыл бұрын
Don't talk rubbish. The lower compression boundary has been defied by Shannon in his works to Information theory. Claiming the brain could infinitely compress data is just as reasonable as claiming the brain could created energy out of nothing. Why do you people talk such nonsense ?
@xhawkenx633
@xhawkenx633 4 жыл бұрын
@@frankschneider6156 and yet you can put 4-5 "items" in your short term memomry, and remember them fully no matter their actual size
@matthewavilez318
@matthewavilez318 4 жыл бұрын
Hard Drives? Nah man, its 2019, we got them SSDs
@darkhorseman8263
@darkhorseman8263 4 жыл бұрын
150tb would be accurate, but you have to realize those memories are stored in an encrypted format that requires large amounts of ephedrine to recover/unencrypt.
@NuclearTopSpot
@NuclearTopSpot 4 жыл бұрын
Well back to meth for school exams then i guess
@everythingwho
@everythingwho 4 жыл бұрын
Plus from what I've learned the brain can change it's capacity, while computers of course cannot
@timothycurnock9162
@timothycurnock9162 4 жыл бұрын
Well said. My "intelligent statement of the month" award I gift to you if you accept. We owe you a coke.
@everythingwho
@everythingwho 4 жыл бұрын
@@timothycurnock9162 haha thanks It's just leftover knowledge from one of my computer science assignments lol
@mufradr
@mufradr 3 жыл бұрын
@@everythingwho well technically computers can, you can plug in flash drives hard drives ssd's etc
@jkm7983
@jkm7983 4 жыл бұрын
I wonder what would happen if an immortal being reaches this limit. Would the oldest memories be deleted to make room or would new memories not be stored
@pauldeddens5349
@pauldeddens5349 4 жыл бұрын
Well old memories are constantly being forgotten, the size of memories themselves are likely very small, perhaps being encrypted by the emotions tied to them, since certain emotions or senses can instantly bring back memories If someone does actually hit the limit, anything could really happen A new disease that eats memory, physical pain from having to much memory, also eating memory Perhaps an overflow error, and the entire brain resets to 0, making the person remember nothing, not even how to walk, making them mentally like a newborn
@tavdy79
@tavdy79 4 жыл бұрын
There are other options, like DNA. Since it is *literally* a data-storage medium, it should be possible to use DNA to store memories, and compared to other media it has two major advantages (plus one possible third). Firstly it is easily duplicated yet remarkably stable, capable of surviving for thousands of years under the right circumstances. This means making backup copies of a memory would be relatively easy. Secondly, the data density for DNA storage is mind-bogglingly high. In theory you could store the sum total of all human knowledge in just a few grams of DNA, even with triple redundancy, so the memories of one sapient, even one millions of years old, would take up a tiny amount of space. The possible third advantage is that any organism which uses DNA to code for proteins etc. already has the physical mechanisms needed to code memories onto DNA. This makes it theoretically possible for DNA to augment human memory without any major changes to physiology outside of changes to our neurons, as memory-DNA could be stored within specialised organelles inside those cells. The key drawback is that, while synaptic memory is immediate-access, DNA memory would not be. Any encoded memories would have to be translated by mechanisms within the storage organelles, and after enough time there would be so much data within a brain that finding a specific memory might take a while. However even that has advantages, is it would require a degree of conscious management of memories. This means you could selectively dump all those embarrassing incidents at school into memory-DNA, and they'd stop troubling you at 3am in the morning because they'd no-longer be in your synaptic memory.
@airysquared
@airysquared 4 жыл бұрын
If they couldn't transcend that kind of limitation, I imagine that some process analogous to deduplication would take place.
@lalaland1427
@lalaland1427 4 жыл бұрын
Lol I forgot what I ate yesterday, as long as it's uneeded for survival (danger/source of happiness etc) and not needed in daily life (often activated) , every thing fade eventually I guess. Immortal beings with a human brain would probably forget easily what's beyond the 1 century mark honestly
@beayn
@beayn 4 жыл бұрын
All I know at 44 years old is that my memory definitely doesn't work as well, and it seems like when I learn stuff, I forget other stuff, so I'd say I'm at capacity.
@frankschneider6156
@frankschneider6156 4 жыл бұрын
You should get rid of unnecessary stuff. You don't really need to know, what your mother looks like, what your name is, how to use a toilet or how ro not drool on your clothes. Just get rid of that superfluous junk and use the thus freed space for more valuable things, e.g. the names of all Pokemons
@psycoNaughtplaysMCPC
@psycoNaughtplaysMCPC 4 жыл бұрын
I heard there were theories of the brain being able to store well into the petabite range
@trelligan42
@trelligan42 4 жыл бұрын
If you add up a lifetime of sensory reception and factor in the limits of color/luminosity of sight, frequency/volume of hearing, and add a bit for haptic sensing, you come in around a petabyte of sensation. Since memories are formed from sense impressions and built-in instinct seems to be truly minimal in humans, this is a sort of maximum of what information a person can be exposed to. Thus our memories (even if perfect) can't exceed this amount. Which is a bit chilling; petabyte servers are rather common in today's server market, and even within the reach of (wealthy) consumers at a little over $100,000.00 (2019). And the price is going down; SSD storage just jumped to 8 Terabytes per unit (PCI mount) - expensive now, but cheaper as soon as production ramps up. So a paralyzed person could have a wide-screen, surround-sound system feeding them a normal lifetime's worth of experience. This rather than the sensory-deprivation lifestyle of only a few decades ago. With brain scanning (or some other feedback mechanism) they could even have interactivity for some multiple of this storage.
@guillaume6373
@guillaume6373 4 жыл бұрын
Wasn't that from the movie elysium or something haha
@trelligan42
@trelligan42 4 жыл бұрын
@Guillaume: Haven't seen that one. Ah, same director as District 9. I've got that one in the queue now, thanks.
@BanditLeader
@BanditLeader 4 жыл бұрын
2.5 petabytes actually
@Nono-hk3is
@Nono-hk3is 4 жыл бұрын
Do we know how memories are stored? Years ago the theory was that the interconnections of neurons defined memory while the firing of neurons defined active thought. If that's still believed to be true (I doubt it is but I'm realizing as I type how ignorant I've become on this subject) then the number of states in a neuron control computational complexity, not memory capacity. Computers have a fairly clear line between processing capacity and storage capacity, but I doubt the architecture of brains are as clearly delineated.
@Laezar1
@Laezar1 4 жыл бұрын
You also have to account that brains work with both electric impulses and chemical reactions. Which can make brain further diverge from computers.
@lalaland1427
@lalaland1427 4 жыл бұрын
I hear that memories are not "stored" but rather "reconstructed" each time they are invoked. So a memory is more like reactivation of the neuronal state you were in at a certain point (vision, touch, smell, meaning, etc). This also explains why memories are rarely static, they change a little bit everytime they are re-invoked, adding new thoughts and context each time. As for those that are not re-invoked and hold no significant emotional value... They fade... Because brain say : I shall not waste ressources on things useless for everyday life or survival.
@never._.mind._.
@never._.mind._. 3 жыл бұрын
@@lalaland1427 interesting, another question, if someone is more emotional/ sensitive, is his/her capacity to invoke memory better than other human?
@lalaland1427
@lalaland1427 3 жыл бұрын
@@never._.mind._.to answer "if someone is more emotional, is their capacity to invoke memory "better" than others ? ". Well there are several possible explanation I would say. (I'm not a specialist on the subject, I am just really interested. So please don't take my answer as an undeniable truth) To give a few explanations that seem realistic to me : - their "sensitive pathways", or neural networks involved in emotions could be more used than in other people (because of training, or they were raised to care for others for example, I don't know I'm giving ideas). The consequence would be that they have more connexions with other neural networks (thus more contexts in which "emotion" is coming up) The neural connexions could be faster too (as in, the electric signals pass faster, because neurons can facilitate the passage on some part of the network. Kind of like greasing the way to improve gliding) - the emotional sensitivity could also be related to genetics, maybe. Some people are more prone to depression for example (and addictions, it's kind of related, due to some chemical receptors being used in both situations) - sensitivity can also come from lack lf habituation. Example : you live in the cold every day of the year, you get kind of insensitive to the cold, especially compared to someone living in the sahara. Same thing with personal relationships : you live in a big city, you get kind of insensitive to the massive number of people around. Because brain says : it's normal, I don't need to pay attention to those stimuli I receive massively everyday. But people with less social interaction take in EVERYTHING and are more easily overwhelmed. Thus "extra-sensitivity" can also be a problem of paying too much attention, being unable to sort out what is relevant and what is not so much relevant. It's an unconscious attentional process, there are several kinds of attention, and this one is the "so fast it's barely noticeable, even less controlable" kind. It's like the attention you pay when a sudden loud noise happen. You usually don't control the flinch ( It can be trained though. Meditation for example is a good way to improve attentional concentration and learn to avoid undesired stimuli. Or crowd diving. Whatever suits you best). Some people have conditions provoking some problems with attention too (some forms of dislexia involve a reduced visual attention span for example, some schizophrens cannot pay attention to the right parts of a face when they are looking at someone, thus they become "emotionally weirded out" as in scared or absolutely certain the person wants to harm them because they can't read their expression correctly. So emotional sensitivity could also be related to the pattern your eyes make when looking at someone's face. Maybe an emotional person is lingering more on expressive areas ? Or they are able to decipherate more informations than the average person ? So many possible explanations, so I'm sorry, I can't answer your question very precisely, but I hope this helped you a little.
@never._.mind._.
@never._.mind._. 3 жыл бұрын
@@lalaland1427 thanks.. i'm very satisfied with your explanation, i shouldn't use "sensitive", i was referring to "emotional value" you mentioned earlier.. your point about out-of-ordinary stimuli made sense too, maybe people tend to remember something new/shocking than the ordinary stimuli.. i have other question, is the earliest human memory cannot be fully retrieved? or reconstructed as you said? or only the ones with emotional value can be remembered? have you ever triggered to remember your insignificant/ordinary long-term memory by certain stimuli? with no emotional value..
@oddowlomen9921
@oddowlomen9921 4 жыл бұрын
I can visually remember most of every movie I have ever watched. My brain likes to pirate movies...
@peter4210
@peter4210 4 жыл бұрын
If i'm not wrong, you can't remember an image exactly, but details. You never remember a memory exactly, you recreate it from the details in you mind, that's why you can accidently alter your own memories. It is also why most peoples earliest memories are made up memories from before the brain is developed enough to to have long term memory. Therefore you cant visually remember a movie, and the longer you don't see it but recollect it, the more you change details and aspect of it. My ability to manipulate 3d shapes in my mind is superior to the average on IQ tests but i can't fully image the monalisa, just parts of it at a time
@EnGalenPerson
@EnGalenPerson 4 жыл бұрын
YOU WOULDN'T STEAL A CAR
@oddowlomen9921
@oddowlomen9921 4 жыл бұрын
@@EnGalenPerson My kid brain: "I would totally steal a car. Guess I'm doing the movie thing, too!
@oddowlomen9921
@oddowlomen9921 4 жыл бұрын
@@peter4210 I think Mona Lisa, and all the portions I've ever cared to notice come to mind. The more I've seen it, the closer attention I've paid, the clearer and easier the visualization becomes. Daydreaming in a way.
@peter4210
@peter4210 4 жыл бұрын
@@oddowlomen9921 yes but i dare you to see her smile in your mind and also think of the separation of the ground and the sky in the back ground at the same time and not lose details about her lips. If it takes you more then 1 try to keeps both in mind you probably altered your own memory to think of both at the same time, probably lost some details in the process and cant think if her right hand is on top of her left hand
@catcatcatcatcatcatcatcatcatca
@catcatcatcatcatcatcatcatcatca 4 жыл бұрын
Two things pop into mind: Computers have both storage and memory. Brains don't have such a neat distinguish between the two, but I think it's safe to assume all states of all synapses aren't available for storing data. Datastorage and processing time are exchangable: the most intuitive example for me is prime numbers: I don't remember all primes smaller than 50, yet I can figure them out in my head. Neural network machine learning can be used to make simulations or predictions, which othervice would need huge datasets or a lot of processing power. Yet a neural network can from much smaller amount of variables return "close enough" results on wide variety of cituation, remembering only fraction of the data, and using only fraction of the processing power. I think it's safe to say our brains can return much larger sets of data than could be stored in bits in them, and the answer isn't in how many bits each neuron can hold. But similiarly our brain does a lot of things like seeing, hearing, feeling and pattern recognition that simply can't be exchanged or considered asnstored data, even if it takes away the same resources.
@sdfkjgh
@sdfkjgh 4 жыл бұрын
Oddball Computer: clockspeed of 120 yottaflops, storage capacity of 27MB.
@dragon67849
@dragon67849 4 жыл бұрын
That's a fast yet tiny computer
@shaunmeldrum4302
@shaunmeldrum4302 4 жыл бұрын
My brain has a hard drive, which is what makes NNN so difficult.
@general_prodigy
@general_prodigy 4 жыл бұрын
Humans: "We can finally store data in the form of solid state!" Aliens: Visit Earth to store data in Human's Brains
@abzuck5043
@abzuck5043 4 жыл бұрын
😂
@shyaammohan8975
@shyaammohan8975 4 жыл бұрын
I love your scishow tangents and I always make time to listen , keep on making !! 💯🤘😄
@danielledorchester9739
@danielledorchester9739 4 жыл бұрын
Wow if this is true we should all be getting phds. But seriously, I think about this all the time thanks for making an episode!!! Love how SciShow answers the nerdy questions that keep me up at night, so I can sleep a little sounder.
@annaviragklausz
@annaviragklausz 4 жыл бұрын
I’m having a study break as I’m studying to my last finals in law school. I clicked so fast.. 😅 I feel like I’m reaching my limit.. 😅🤯
@sandreid87
@sandreid87 4 жыл бұрын
Best of luck! :D
@lunacouer
@lunacouer 4 жыл бұрын
Good luck to you!! Happy passing out after the last test is finished. :)
@annaviragklausz
@annaviragklausz 4 жыл бұрын
Oh thank you guys! ☺️📖☕️🙏
@svenmorgenstern9506
@svenmorgenstern9506 4 жыл бұрын
And then - bar exams! Hang in there, you've got this! 👍
@KevinP32270
@KevinP32270 4 жыл бұрын
GODSPEED.
@Aziraphale686
@Aziraphale686 4 жыл бұрын
I've always loved thinking through this thought experiment. The brain is a finite volume, so it can only store a finite amount of information, which means that you could theoretically 'fill up' your brain at some point. How long would you have to live for that to happen? What happens when a full brain tries to learn something new? How does it decide what to 'forget'?
@JCcanU
@JCcanU 4 жыл бұрын
Never will get full the brain of a Very healthy 85 year old male who has been doing labor his entire life can recall a lot of odd jobs he did and still recall all the tools he used his entire life , he may not recall what he had for dinner 4 days ago . that kind of info is useless , but cooking a meal will be right at hand even if it wa something he had not cooked in 30 years. songs from 1934 to 2019 movies tv shows , all that is in the thought process . The Brain is a wonderful .
@Reconcilography
@Reconcilography 4 жыл бұрын
And of course it gets even more complicated by the fact that synapses aren't the only way neurons store information! Neurotransmitters from one synapse can float through interstitial fluid to reach nearby synapses, or even nonsynaptic receptors, allowing for wildly complex analog data transmission.
@johnyliltoe
@johnyliltoe 4 жыл бұрын
Spacious, but also the applications they're running are huge.
@matthewcox7985
@matthewcox7985 4 жыл бұрын
taskkill /f /im consciousness.exe
@johnyliltoe
@johnyliltoe 4 жыл бұрын
@@matthewcox7985 Oh fu....
@scottieray
@scottieray 4 жыл бұрын
This doesn't even take into account for dreams which are miraculous to me. While we sleep our minds are creating people, places, events that can feel very real, yet may have never actually occurred. It really blows my mind.
@NoahNobody
@NoahNobody 4 жыл бұрын
How my brain storage works... Things I need to learn to help me in life: 4kb. All the bad things that have happened to me in my entire life: 999TB.
@dragon67849
@dragon67849 4 жыл бұрын
#feelsbadman
@jaredhamon3411
@jaredhamon3411 4 жыл бұрын
"thought experiment"
@Shazzkid
@Shazzkid 4 жыл бұрын
I can hold a solid 3-4MB at most, its also easily corruptable
@sandreid87
@sandreid87 4 жыл бұрын
I remember when I was a kid, having MBs on your harddrive was impressive. As a teenager, it was all about GBs, and now it's been TBs for quite a few years. I wonder how many more iterations I'll see in my lifetime.
@kinpatu
@kinpatu 4 жыл бұрын
And back then people were asking the same question. The answer was usually something like 10s of MBs.
@svenmorgenstern9506
@svenmorgenstern9506 4 жыл бұрын
Assuming Moore's Law holds out, quite a bit. I'm old enough to remember when having 100 MB on a hard drive you could hold in 1 hand was pretty impressive. Sealed hard drives for minicomputers could get to a gig or so, but took 2 people to pick up. Drives with dismountable disk packs were about the size of a small washing machine & held about 350 MB, give or take.
@jokuvaan5175
@jokuvaan5175 4 жыл бұрын
@@svenmorgenstern9506 Moore's law is coming to it's limit. It's becoming physically impossible to increase the number of transistors on CPUs because in good modern CPUs the width of conductors between the trasistors is something like 9 conductor ATOMS! It's insane. Now we'll just have to wait for quamtum computers or something to compleatly break the law
@kinpatu
@kinpatu 4 жыл бұрын
Sven Morgenstern I started with 8” floppy drives and a reel to reel tape storage system. Then moved onto cassette tape for storage. That was revolutionary.
@thegenerousdegenerate9395
@thegenerousdegenerate9395 4 жыл бұрын
The fact that they can store gigs on something literally the size of a stamp still boggles my mind. I mean I understand it. Its just the fact that we figured it out and can mass produce millions of them for next to nothing is what gets me. We're living in star trek. Lol
@Locut0s
@Locut0s 4 жыл бұрын
I don’t think our brains really store so much as construct and reconstruct a lot of the “data” that we think is up there. We might store some of the most basic building blocks of cognition the way a hard drive does, things like concepts, and words. But for things like memories of all kinds I think our brains reconstruct these each time we try to recall them. Which is why memory is so fallible and organic.
@ReasonablySkeptic
@ReasonablySkeptic 3 жыл бұрын
"this is more of an educated wild guess" the prefect definition of science. It's not about absolute truth, it's the process by which we come to conclusions leading to a stack of "educated wild guesses". SCIENCE!
@gammarayneutrino8413
@gammarayneutrino8413 3 жыл бұрын
No, it's an educated wild guess because it is: 1- Cutting edge. 2- Trying to compare 2 very different systems. Trying a more established theory, and you'll get better answers. Try a mathematical theory, and you'll get %100 definite answers %100 of the time.
@Bird-0
@Bird-0 2 жыл бұрын
If "thousands" is assumed to be 2,000, would the total bytes not be approximately 1.7 petabytes? That's what I'm getting in my head
@hiiamelecktro4985
@hiiamelecktro4985 4 жыл бұрын
Aah yes the pinnacle of storage: DVD
@alan202
@alan202 4 жыл бұрын
Jokes on you I use SSD's in my computer
@cornlips7247
@cornlips7247 4 жыл бұрын
What is the joke? Unless faster means more capacity( it does not as far as I know) I do not get it.
@alan202
@alan202 4 жыл бұрын
@@cornlips7247 at the start of the video they said they use hard drives but most people just use SSD's now
@cornlips7247
@cornlips7247 4 жыл бұрын
@@alan202 I must have missed them saying that thank you. I doubt Stats would back up that most people claim though. A lot do but I would guarantee it is not most people yet.
@Azaelris
@Azaelris 4 жыл бұрын
@@alan202 ssds are expensive. I have one but it's for the operating system files
@SkyreeXScalabar
@SkyreeXScalabar 4 жыл бұрын
@@Azaelris no they're the cheapest they have ever been right now, 1 tb for around $100 and it's in m.2 form factor so no wires just stick into the motherboard and faster than SATA
@Phane02
@Phane02 4 жыл бұрын
While I don't have an eidetic memory, I remember a good deal about almost every year in my life with the earliest somewhere between age 2 and 3. I still remember getting a diaper change, lying down in my crib staring upwards at the rails, and drinking baby formula from a bottle including the taste and its texture. I'm 39 now, but all of it is as fresh as yesterday which makes forgetting so damn difficult.
@MrLonerforever
@MrLonerforever 4 жыл бұрын
Love and respect to all of you Scishow hosts
@greensteve9307
@greensteve9307 4 жыл бұрын
Great comment. A year ago the comment section of any of Olivia's vids was full of negative comments about her appearance. It's great to see that has stopped.
@pakainnamansenyo10
@pakainnamansenyo10 4 жыл бұрын
150 TB to zero real quick when you got a mental block.
@RybackTV
@RybackTV 4 жыл бұрын
Good to know.
@eminem565
@eminem565 2 жыл бұрын
Ayyy ryback. It's time to feed your brain. Feed me more.. ahhhh...
@4G12
@4G12 4 жыл бұрын
Instead of base 2, we have at least base 26. We are just scratching the surface to understanding the true mechanics and potential power of our brains.
@MrTheguywiththemoney
@MrTheguywiththemoney 4 жыл бұрын
Better question, why can't some people store any information?
@cah8291
@cah8291 4 жыл бұрын
der Jakob I think you have to ask a more specific question. Because there are different types of information and regions of our brain are specialized for processing different information. Everyone that has been born can store information in their brain. The problems come in how the brain interprets it, if it interprets it at all, and how we respond consequently.
@thugasaurusrex6004
@thugasaurusrex6004 4 жыл бұрын
That actually is a better question lol nice. Amnesia and other memory related ailments aren't really well understood
@moki2093
@moki2093 4 жыл бұрын
Their sata connector broke
@MrTheguywiththemoney
@MrTheguywiththemoney 4 жыл бұрын
@@moki2093 I think their logic gate has malfunctioned
@tomstech4390
@tomstech4390 4 жыл бұрын
Bad sectors or firmware.
@pogocat59
@pogocat59 2 жыл бұрын
1:38 This means that our brain is kind of like a quantum computer? (For example a byte in a quantum computer can be not just 0 or 1 but, it can be in-between.)
@X9Diamond
@X9Diamond 4 жыл бұрын
Makes sense. The brain is not only able to store information its able to process information and predicts the future.Its an amazing ability to know what will happen even before it happens. These ability lets you have conversations were you can respond to the other person with many different scenarios created on your head. If you train yourself hard you can then achieve lucid dreaming and future sight witch lets you experience deja boo. To bad the brain is limited to a certain speed or else your brain will overheat and by goes your sanity.
@pierreabbat6157
@pierreabbat6157 4 жыл бұрын
How much of that is what's commonly called "memory"? Somewhere in the brain is a network that recognizes every letter of all the alphabets we know, somewhere else is stored how to play the concertina, another part controls the lungs, ...
@crimsonemperor2219
@crimsonemperor2219 4 жыл бұрын
The brain has lots of space to store data, that's all well and good, but it lacks a reliable way to call back said data. False memories and memory deterioration are more common than not, I'd consider that a major flaw of the brain
@pauldeddens5349
@pauldeddens5349 4 жыл бұрын
To be fair, the brain wasn't evolved to use its memory like it would in modern day Humans would memorize hunting strategies, friends, enemies, animals, locations, food, weather, natural disasters, and a few other stuff, but nothing along the lines of what modern humans have to learn now No fancy math, no weird false memory tricks, no easy way of spreading knowledge, it would probably make it a lot easier for a feral human to retrieve memories, though its unclear, since feral humans are very rare, and cant learn to talk
@lohphat
@lohphat 4 жыл бұрын
The problem is that the static model of storage doesn’t map to our dynamic memory. Our memories are fluid and each recall of memory changes the synaptic weight of the response, so linear analogies don’t apply.
@user-xb5oo5dd4f
@user-xb5oo5dd4f 3 жыл бұрын
The creation of of God will always amaze me!
@Dhalin
@Dhalin 4 жыл бұрын
I would say the Brain is more like RAM in a computer than the HDD, because once it is turned off, the data is all gone. It's volatile. You could also make other interesting parallels like damaged RAM and damaged parts of the brain, and/or degradation due to age.
@northside240
@northside240 3 жыл бұрын
The memory capacity of the human brain was reported to have the equivalent of 2.5 petabytes of memory capacity. As a number, a “petabyte” means 1024 terabytes or a million gigabytes, so the average adult human brain has the ability to store the equivalent of 2.5 million gigabytes digital memory.
@yorkerold
@yorkerold 4 жыл бұрын
Damn, the human brain can be pretty OP.
@stevenutter3614
@stevenutter3614 4 жыл бұрын
Our brains are all like broken hard drives that only run in data recovery mode. If we're lucky and it was just yesterday that we emptied our recycling bin we might be able to get the majority of that important message back, but chances are we'll misremember it.
@adm0iii
@adm0iii 4 жыл бұрын
All indications are that synapses are analog, not digital. That means the number of states they can have has no real limit; each of the uncountable number of different states can each have different interpretations, i.e. represent different values. That means can't be equated to a bit, or a couple bits, or a few bytes, or any other reasonable number of _digital_ states. It all depends on how the states are interpreted, but in the brain, these interpretations are _also_ analog, so all we can say is that the information capacity for a synapse is unknown, but could be "quite a lot". That's about as far as you can take this kind of comparison.
@Healthandwealth9422
@Healthandwealth9422 2 жыл бұрын
We’re going to need this when we upload our memories to the computer that computer will have to convert the natural memories into computer storage
@EverythingScience
@EverythingScience 4 жыл бұрын
With how I can just randomly remember the most minuscule detail of something that happened to me a decade ago I would have thought our brains had way more storage
@abloogywoogywoo
@abloogywoogywoo 4 жыл бұрын
Biologist: By computer standards, you are a marvel. You have virtually unlimited potential and space for storing information with your brain. Me: [focuses on only all the bad memories and everything I ever got wrong] D=
@scottcupp8129
@scottcupp8129 4 жыл бұрын
The brain is extreeeemelyyy efficient. If anything, I would think our brain is like a quantum computer.
@jasonwebb1882
@jasonwebb1882 4 жыл бұрын
Just think about how much your brains doing at 1 time. Not even by our will it does more work and speed that not 1 super computer could keep up. It really is amazing what goes on in the human body. I know more about space than I will ever dream about in my own body.
@DimitriosSpyridonChytiris
@DimitriosSpyridonChytiris 4 жыл бұрын
what a great question and answer! i loved it
@justadragonnamemarcus1751
@justadragonnamemarcus1751 4 жыл бұрын
Me : trys to delete cache data Also me : forgot my homework
@AutisticThinker
@AutisticThinker 4 жыл бұрын
0:09 - Nit pick... Not all computer storage is called a "hard drive", solid state drives are not "hard drives", but are replacing hard drives.
@Noodles.FreeUkraine
@Noodles.FreeUkraine 4 жыл бұрын
And just like hard drives, some people's heads are filled with helium. Checks out.
@c12486
@c12486 4 жыл бұрын
I was just wondering this, so awesome 😍😎
@Armbreakfire
@Armbreakfire 4 жыл бұрын
So what I'm understanding is that the 8% difference means at least 26 different states. But if they did another study and saw a smaller percentage (say 3%) there would be a lot more possible states. That means the brain could actually have a much larger capacity, but it is at least 150 TB based on the 8% figure.
@pegasusted2504
@pegasusted2504 4 жыл бұрын
I know a more than a few people with "spacious" brains, lots of space lol. ;~)
@emmanuelweinman9673
@emmanuelweinman9673 4 жыл бұрын
love this woman! whenever people love what they do they make you love it too! Brains are Waaayyyy cooler than computers though, they not only store memory, they also store awareness and make our whole bodies function!
@1jotun136
@1jotun136 4 жыл бұрын
Thanks Olivia, always nice to see you.
@Beryllahawk
@Beryllahawk 4 жыл бұрын
So spacious. That's why I lose everything I try to remember! It's rattling around in there :P
@ziqi92
@ziqi92 4 жыл бұрын
What the hell is the point of 150TB of storage if most of it is corrupted?
@infinitebeing1119
@infinitebeing1119 2 жыл бұрын
Brain has the capability to access unlimited (limitless knowledge). It is the recieving organ not the storing organ. The knowledge is stored in the mind.
@persiankingish
@persiankingish 4 жыл бұрын
*Megamind: hold my beer*
@humpty4205
@humpty4205 4 жыл бұрын
Megamind: Hold my brain
@humpty4205
@humpty4205 4 жыл бұрын
Brain seems to overlap information on same set of neurons. So memory retrieval becomes corrupt and we remember unintended extra things when trying to consciously remember something.
@deeb3272
@deeb3272 4 жыл бұрын
The brain studying naming and studying itself.
@MusicalRaichu
@MusicalRaichu 4 жыл бұрын
I wonder what the equivalent in bits is in our brain for doing tasks like learning how to cook a particular recipe, playing a song on an instrument, memorizing lines in a play (or in a sci-show video), etc.
@determineddaaf3
@determineddaaf3 4 жыл бұрын
My brain can store about 3 bytes. Eating, Sleeping, Going to the toilet
@km1dash6
@km1dash6 4 жыл бұрын
The brain isn't a computer. It's a very useful metaphor, but brains are good at pattern recognition, and computers are good at data storage. I can't remember what I had for breakfast last week, but a computer can tell you what processes were operating at 9:42 am last Saturday. I can tell you that a picture of a dog is a picture of a dog, and that a picture of a cat is a picture of a cat, but it's taken a long time for computers to be able to scan photos for information, and they're not even that good at it. Small things like dots can throw off a computer's ability to "see" things.
@maxsalmon4980
@maxsalmon4980 4 жыл бұрын
150TB sounds like a lot, but I'll need to shop around for an external drive sooner or later.
@cezarcatalin1406
@cezarcatalin1406 4 жыл бұрын
Max Salmon Where are you planning to plug it ? ( ͡° ͜ʖ ͡°)
@tarttooth6022
@tarttooth6022 4 жыл бұрын
My brain is a 2GB flash drive that keeps rewriting itself.
@thekeyboard11
@thekeyboard11 4 жыл бұрын
Thanks. Now I’m going to use my brain for my computer now.
@SlySean44
@SlySean44 4 жыл бұрын
Some say we have 2.5 petabytes (2500 terabytes)
@paul_308
@paul_308 4 жыл бұрын
I thought the same thing, but after taking another look into it, I'm sure I was just thinking about DNA storage. Look into it. The amount of information that can be stored in a gram of DNA is enormous.
@samsmusichub
@samsmusichub 4 жыл бұрын
Fields. Endless, fields.
@TheRealGuywithoutaMustache
@TheRealGuywithoutaMustache 4 жыл бұрын
How much data can be stored in our brain? Average human: A lot Me: -76kb
@alexandercanella4479
@alexandercanella4479 4 жыл бұрын
But you remembered English. So I'd say at least +67kb
@seemathakur4357
@seemathakur4357 3 жыл бұрын
Bro you in every video i watch
@jeremywj
@jeremywj 3 жыл бұрын
In comparing to a computer, another issue is the "completeness" of the memory/information stored. If you save a video from your webcam to a computer, it is going to be a pretty much an exact "memory" of what it saw that can later be played (remembered) exactly as it originally was. Our brains however basically only remember the important "bits" (pun intended) and we fill in the gaps with what we assume was there when we reference that memory. This makes it seems like our brains are able to store an enormous amount of information. Think about a person in their 90's, of sound mind, and all the memories they have available to them. It would surely exceed way past the referenced 30TB in the video. However, being that each memory is really only a small portion of the original input, even a lifetime's worth of memories, in my opinion, wouldn't fill up a 1TB drive. I think the majority of the stored information in our brains is more about knowledge vs memory (kind of the same thing, kinda not). For example, language, motor movement, and other daily tasks probably consume 90% or more of our storage space, leaving only a small amount for the true memories.
@SecretEyeSpot
@SecretEyeSpot 4 жыл бұрын
"back of the envelope math" i love it lol
@kolecava
@kolecava 4 жыл бұрын
Brain works more like a cache disk. When you use the information more it is easily accessible. If you learn something but then to never use it again, it will most likely be forgotten, or put into "cold" storage where it will only be accessed upon 1 specific prompt (smell, word, sound etc). I doubt you can specify an exact number of bits the brain can store, but at the same time, I doubt the brain is infinite. Unless the brain grows with the more you know, hence why we have bigger brains then that would make it "infinite". Without a doubt there is different types of memory in human brains, some recollect faster, some have better capacity to memorise etc...
@ultralaggerREV1
@ultralaggerREV1 Жыл бұрын
Conclusion: our synapses are literally QUANTUM bits
@johnjordan3552
@johnjordan3552 4 жыл бұрын
How much data can brain store? -Yes
@tawon1984
@tawon1984 4 жыл бұрын
My brain holds about nine PS2 memory cards worth of data 👍
@eidolor
@eidolor 4 жыл бұрын
So I have room for 15 more homework folders in my brain
@ViktorNyberg
@ViktorNyberg 4 жыл бұрын
The problem here is that not only the voltage carries information. Even action potentials that don't trigger another action potential in the receiving neuron will influence the receiving neuron. And depending on the neuron and activation it will release different kinds of neurotransmitters. And sometimes more than one.
@wreck-itralph938
@wreck-itralph938 4 жыл бұрын
Enough to forget that I have homework
How Cheap Cigars Legitimized Quantum Mechanics
12:05
SciShow
Рет қаралды 111 М.
What is the Strongest Magnet We Possibly Could Make?
14:41
SciShow
Рет қаралды 1,6 МЛН
ОСКАР ИСПОРТИЛ ДЖОНИ ЖИЗНЬ 😢 @lenta_com
01:01
1 or 2?🐄
00:12
Kan Andrey
Рет қаралды 54 МЛН
How We Could Prevent a Global Rice Shortage
6:06
SciShow
Рет қаралды 156 М.
11 Things That Can Change Your Eye Color
12:24
SciShow
Рет қаралды 234 М.
Why Are There 7 Days In a Week? EXPLAINED
16:04
Be Smart
Рет қаралды 2 МЛН
Magnifying The World's Brightest Flashlight (200,000 Lumens)
8:55
The Action Lab
Рет қаралды 223 М.
How Your Memory Works
9:46
Be Smart
Рет қаралды 2,3 МЛН
The Sharpest Object In The World Can't Cut Anything
11:32
SciShow
Рет қаралды 4,9 МЛН
Engrams: Where Your Brain Keeps Memories
6:21
SciShow Psych
Рет қаралды 91 М.
How are memories stored in neural networks? | The Hopfield Network #SoME2
15:14
Chinese Magic Mirrors are really clever
11:09
Steve Mould
Рет қаралды 2,2 МЛН
ОСКАР ИСПОРТИЛ ДЖОНИ ЖИЗНЬ 😢 @lenta_com
01:01